Incidental Mutation 'R4588:Sparc'
ID342626
Institutional Source Beutler Lab
Gene Symbol Sparc
Ensembl Gene ENSMUSG00000018593
Gene Namesecreted acidic cysteine rich glycoprotein
SynonymsBM-40, osteonectin
MMRRC Submission 042007-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4588 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location55394500-55423183 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55405236 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 121 (M121V)
Ref Sequence ENSEMBL: ENSMUSP00000149918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018737] [ENSMUST00000108858] [ENSMUST00000141530] [ENSMUST00000213866] [ENSMUST00000214685] [ENSMUST00000216313]
Predicted Effect probably benign
Transcript: ENSMUST00000018737
AA Change: M91V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000018737
Gene: ENSMUSG00000018593
AA Change: M91V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 22 42 N/A INTRINSIC
FOLN 70 93 5.24e-8 SMART
KAZAL 93 148 1.16e-9 SMART
Pfam:SPARC_Ca_bdg 151 288 5.3e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108858
AA Change: M90V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104486
Gene: ENSMUSG00000018593
AA Change: M90V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 21 41 N/A INTRINSIC
FOLN 69 92 5.24e-8 SMART
KAZAL 92 147 1.16e-9 SMART
Pfam:SPARC_Ca_bdg 150 287 1.1e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125787
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130642
Predicted Effect probably benign
Transcript: ENSMUST00000141530
AA Change: M89V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119475
Gene: ENSMUSG00000018593
AA Change: M89V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
FOLN 68 91 5.24e-8 SMART
KAZAL 91 146 1.16e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213866
AA Change: M121V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000214685
AA Change: M91V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000216313
AA Change: M121V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.1041 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cysteine-rich acidic matrix-associated protein. The encoded protein is required for the collagen in bone to become calcified but is also involved in extracellular matrix synthesis and promotion of changes to cell shape. The gene product has been associated with tumor suppression but has also been correlated with metastasis based on changes to cell shape which can promote tumor cell invasion. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cataracts, reduced skin collagen content, accelerated wound closure, osteopenia associated with reduced bone remodeling, and increased growth of implanted tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 79,997,867 probably null Het
Abcb4 A T 5: 8,947,328 I936F probably benign Het
Adnp2 G T 18: 80,128,648 L849I probably benign Het
Atf7ip T C 6: 136,599,694 S1032P probably benign Het
Atr A C 9: 95,865,667 D334A probably benign Het
Atrip A T 9: 109,060,279 D20E probably damaging Het
Atxn7 T A 14: 14,096,268 C43* probably null Het
Cfap65 C A 1: 74,904,056 Q1603H possibly damaging Het
Cpne5 T C 17: 29,164,713 I327V probably benign Het
Ctsa T C 2: 164,834,150 S41P possibly damaging Het
Cyp4x1 A T 4: 115,108,797 L444Q probably damaging Het
Dchs1 C A 7: 105,756,041 M2431I probably benign Het
Ddi1 T A 9: 6,266,003 H122L probably benign Het
Defa21 C T 8: 21,025,648 P21S probably damaging Het
Ect2 A G 3: 27,147,000 V77A probably damaging Het
Ermap C A 4: 119,188,248 probably benign Het
Fancm G A 12: 65,118,441 probably null Het
Gcnt3 T A 9: 70,034,230 D352V probably damaging Het
Gys2 A G 6: 142,449,455 M428T possibly damaging Het
Igtp T A 11: 58,206,682 N226K probably damaging Het
Itpr2 T A 6: 146,241,196 H1675L probably benign Het
Lipo4 G A 19: 33,499,247 P367L possibly damaging Het
Lzts3 T C 2: 130,634,766 *587W probably null Het
Mast3 T A 8: 70,780,607 K300* probably null Het
Mepce G A 5: 137,785,272 T264I possibly damaging Het
Mif4gd A T 11: 115,609,546 I62N probably damaging Het
Olfr307 C T 7: 86,335,644 V251I probably benign Het
Olfr869 T A 9: 20,138,087 *324K probably null Het
Palm3 A G 8: 84,029,386 K509R probably benign Het
Pde11a T C 2: 76,029,303 T821A probably damaging Het
Pik3r5 A G 11: 68,493,261 probably benign Het
Pkhd1 T C 1: 20,200,868 T3154A probably benign Het
Ptprs A G 17: 56,425,534 Y438H probably damaging Het
Rdh8 T A 9: 20,822,729 D70E probably benign Het
Scn2a A T 2: 65,713,767 I831L possibly damaging Het
Selenoo A G 15: 89,096,718 H420R probably benign Het
Slc22a16 T C 10: 40,570,681 probably benign Het
Slc5a1 A G 5: 33,145,288 T208A probably benign Het
Sstr1 G T 12: 58,213,631 A347S probably benign Het
Stab1 C A 14: 31,157,445 V693F probably benign Het
Tnn A G 1: 160,145,111 V307A probably benign Het
Trmt1 A G 8: 84,690,753 probably benign Het
Ttc3 T C 16: 94,442,901 S1255P probably benign Het
Ube2ql1 A C 13: 69,739,157 S62A unknown Het
Vmn2r84 T A 10: 130,385,940 M804L probably damaging Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Vps50 A G 6: 3,562,306 E467G probably damaging Het
Other mutations in Sparc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01768:Sparc APN 11 55405243 missense probably damaging 0.99
IGL01790:Sparc APN 11 55407215 splice site probably null
R1711:Sparc UTSW 11 55395776 intron probably null
R1840:Sparc UTSW 11 55395866 missense probably damaging 1.00
R1859:Sparc UTSW 11 55406508 critical splice donor site probably null
R2172:Sparc UTSW 11 55395801 nonsense probably null
R4860:Sparc UTSW 11 55399211 missense possibly damaging 0.92
R4860:Sparc UTSW 11 55399211 missense possibly damaging 0.92
R7748:Sparc UTSW 11 55398600 missense probably benign 0.01
R7803:Sparc UTSW 11 55409971 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCTTCTCCCTCATGTCTGGAG -3'
(R):5'- TTGCCTGAAACTCTGGTTCTG -3'

Sequencing Primer
(F):5'- TTTGAACTCAGGACCTCTGGAAG -3'
(R):5'- ACTCTGGTTCTGAGAGTGGAGTAC -3'
Posted On2015-09-24