Incidental Mutation 'R4588:Pik3r5'
ID342628
Institutional Source Beutler Lab
Gene Symbol Pik3r5
Ensembl Gene ENSMUSG00000020901
Gene Namephosphoinositide-3-kinase regulatory subunit 5
Synonyms
MMRRC Submission 042007-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R4588 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location68432121-68497849 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 68493261 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021283]
Predicted Effect probably benign
Transcript: ENSMUST00000021283
SMART Domains Protein: ENSMUSP00000021283
Gene: ENSMUSG00000020901

DomainStartEndE-ValueType
Pfam:PI3K_1B_p101 6 871 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155887
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinases (PI3Ks) phosphorylate the inositol ring of phosphatidylinositol at the 3-prime position, and play important roles in cell growth, proliferation, differentiation, motility, survival and intracellular trafficking. The PI3Ks are divided into three classes: I, II and III, and only the class I PI3Ks are involved in oncogenesis. This gene encodes the 101 kD regulatory subunit of the class I PI3K gamma complex, which is a dimeric enzyme, consisting of a 110 kD catalytic subunit gamma and a regulatory subunit of either 55, 87 or 101 kD. This protein recruits the catalytic subunit from the cytosol to the plasma membrane through high-affinity interaction with G-beta-gamma proteins. Multiple alternatively spliced transcript variants encoding two distinct isoforms have been found. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit significantly reduced neutrophil chemotaxis and chemokinesis in vitro and impaired neutrophil recruitment into the peritoneum in a model of thioglycollate-induced aseptic peritonitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 79,997,867 probably null Het
Abcb4 A T 5: 8,947,328 I936F probably benign Het
Adnp2 G T 18: 80,128,648 L849I probably benign Het
Atf7ip T C 6: 136,599,694 S1032P probably benign Het
Atr A C 9: 95,865,667 D334A probably benign Het
Atrip A T 9: 109,060,279 D20E probably damaging Het
Atxn7 T A 14: 14,096,268 C43* probably null Het
Cfap65 C A 1: 74,904,056 Q1603H possibly damaging Het
Cpne5 T C 17: 29,164,713 I327V probably benign Het
Ctsa T C 2: 164,834,150 S41P possibly damaging Het
Cyp4x1 A T 4: 115,108,797 L444Q probably damaging Het
Dchs1 C A 7: 105,756,041 M2431I probably benign Het
Ddi1 T A 9: 6,266,003 H122L probably benign Het
Defa21 C T 8: 21,025,648 P21S probably damaging Het
Ect2 A G 3: 27,147,000 V77A probably damaging Het
Ermap C A 4: 119,188,248 probably benign Het
Fancm G A 12: 65,118,441 probably null Het
Gcnt3 T A 9: 70,034,230 D352V probably damaging Het
Gys2 A G 6: 142,449,455 M428T possibly damaging Het
Igtp T A 11: 58,206,682 N226K probably damaging Het
Itpr2 T A 6: 146,241,196 H1675L probably benign Het
Lipo4 G A 19: 33,499,247 P367L possibly damaging Het
Lzts3 T C 2: 130,634,766 *587W probably null Het
Mast3 T A 8: 70,780,607 K300* probably null Het
Mepce G A 5: 137,785,272 T264I possibly damaging Het
Mif4gd A T 11: 115,609,546 I62N probably damaging Het
Olfr307 C T 7: 86,335,644 V251I probably benign Het
Olfr869 T A 9: 20,138,087 *324K probably null Het
Palm3 A G 8: 84,029,386 K509R probably benign Het
Pde11a T C 2: 76,029,303 T821A probably damaging Het
Pkhd1 T C 1: 20,200,868 T3154A probably benign Het
Ptprs A G 17: 56,425,534 Y438H probably damaging Het
Rdh8 T A 9: 20,822,729 D70E probably benign Het
Scn2a A T 2: 65,713,767 I831L possibly damaging Het
Selenoo A G 15: 89,096,718 H420R probably benign Het
Slc22a16 T C 10: 40,570,681 probably benign Het
Slc5a1 A G 5: 33,145,288 T208A probably benign Het
Sparc T C 11: 55,405,236 M121V probably benign Het
Sstr1 G T 12: 58,213,631 A347S probably benign Het
Stab1 C A 14: 31,157,445 V693F probably benign Het
Tnn A G 1: 160,145,111 V307A probably benign Het
Trmt1 A G 8: 84,690,753 probably benign Het
Ttc3 T C 16: 94,442,901 S1255P probably benign Het
Ube2ql1 A C 13: 69,739,157 S62A unknown Het
Vmn2r84 T A 10: 130,385,940 M804L probably damaging Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Vps50 A G 6: 3,562,306 E467G probably damaging Het
Other mutations in Pik3r5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01345:Pik3r5 APN 11 68496194 missense possibly damaging 0.68
IGL01400:Pik3r5 APN 11 68494547 missense probably benign 0.01
IGL01597:Pik3r5 APN 11 68496001 missense probably damaging 1.00
IGL01622:Pik3r5 APN 11 68486626 splice site probably null
IGL01623:Pik3r5 APN 11 68486626 splice site probably null
IGL01878:Pik3r5 APN 11 68492530 missense probably benign 0.00
IGL01953:Pik3r5 APN 11 68494171 missense probably benign 0.00
IGL02056:Pik3r5 APN 11 68490855 missense possibly damaging 0.86
IGL02345:Pik3r5 APN 11 68492726 missense probably benign 0.03
palmetto UTSW 11 68494233 missense probably damaging 1.00
Palmito UTSW 11 68492000 missense probably damaging 1.00
palms UTSW 11 68486622 critical splice donor site probably null
piranha UTSW 11 68486581 missense probably damaging 1.00
Serenoa_repens UTSW 11 68475424 nonsense probably null
IGL02799:Pik3r5 UTSW 11 68495947 missense probably damaging 0.98
R0077:Pik3r5 UTSW 11 68486622 critical splice donor site probably null
R0092:Pik3r5 UTSW 11 68492803 missense probably benign
R0105:Pik3r5 UTSW 11 68490511 missense probably damaging 0.99
R0118:Pik3r5 UTSW 11 68490480 missense probably damaging 1.00
R1204:Pik3r5 UTSW 11 68494224 missense probably benign 0.03
R1447:Pik3r5 UTSW 11 68494177 missense probably benign 0.18
R1865:Pik3r5 UTSW 11 68492492 missense probably damaging 1.00
R2034:Pik3r5 UTSW 11 68493577 missense probably damaging 0.99
R2356:Pik3r5 UTSW 11 68492917 missense probably damaging 1.00
R4716:Pik3r5 UTSW 11 68495204 missense possibly damaging 0.48
R4960:Pik3r5 UTSW 11 68493638 missense probably benign 0.19
R5217:Pik3r5 UTSW 11 68491964 missense possibly damaging 0.67
R5518:Pik3r5 UTSW 11 68477468 missense possibly damaging 0.86
R5528:Pik3r5 UTSW 11 68495977 missense probably damaging 1.00
R5554:Pik3r5 UTSW 11 68494233 missense probably damaging 1.00
R5693:Pik3r5 UTSW 11 68494251 missense probably damaging 1.00
R5841:Pik3r5 UTSW 11 68492270 missense probably damaging 1.00
R6025:Pik3r5 UTSW 11 68492318 missense probably damaging 0.97
R6168:Pik3r5 UTSW 11 68492675 missense probably benign
R6243:Pik3r5 UTSW 11 68492000 missense probably damaging 1.00
R6322:Pik3r5 UTSW 11 68492741 missense probably benign
R6420:Pik3r5 UTSW 11 68475424 nonsense probably null
R6505:Pik3r5 UTSW 11 68492789 missense probably benign 0.16
R6534:Pik3r5 UTSW 11 68490617 missense possibly damaging 0.59
R6817:Pik3r5 UTSW 11 68486581 missense probably damaging 1.00
R7246:Pik3r5 UTSW 11 68492943 missense probably benign 0.01
R7459:Pik3r5 UTSW 11 68492590 missense probably benign 0.03
R7527:Pik3r5 UTSW 11 68476351 missense probably damaging 1.00
R7739:Pik3r5 UTSW 11 68490498 missense probably damaging 1.00
R7817:Pik3r5 UTSW 11 68493657 missense probably damaging 0.99
R7877:Pik3r5 UTSW 11 68490605 missense probably damaging 1.00
R7885:Pik3r5 UTSW 11 68492702 missense possibly damaging 0.57
R7960:Pik3r5 UTSW 11 68495970 missense probably benign 0.22
R8816:Pik3r5 UTSW 11 68494234 missense probably damaging 1.00
R8836:Pik3r5 UTSW 11 68494278 missense probably benign 0.06
Z1177:Pik3r5 UTSW 11 68492896 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- GAATTTAGAGCCCACCTGGAG -3'
(R):5'- CCATCTTTGTCATGTGGCAG -3'

Sequencing Primer
(F):5'- ACCTGGAGTCCTGACGTCAC -3'
(R):5'- ATGTGGCAGAATGTCCTACC -3'
Posted On2015-09-24