Incidental Mutation 'R4588:Mif4gd'
ID342629
Institutional Source Beutler Lab
Gene Symbol Mif4gd
Ensembl Gene ENSMUSG00000020743
Gene NameMIF4G domain containing
Synonyms
MMRRC Submission 042007-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4588 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location115607918-115612969 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 115609546 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 62 (I62N)
Ref Sequence ENSEMBL: ENSMUSP00000119643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021087] [ENSMUST00000021089] [ENSMUST00000058109] [ENSMUST00000106506] [ENSMUST00000106507] [ENSMUST00000148574] [ENSMUST00000178003]
Predicted Effect probably damaging
Transcript: ENSMUST00000021087
AA Change: I62N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021087
Gene: ENSMUSG00000020743
AA Change: I62N

DomainStartEndE-ValueType
Pfam:MIF4G 4 205 1.4e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000021089
SMART Domains Protein: ENSMUSP00000021089
Gene: ENSMUSG00000020744

DomainStartEndE-ValueType
Pfam:Mito_carr 12 111 5.7e-20 PFAM
Pfam:Mito_carr 114 205 5.3e-24 PFAM
Pfam:Mito_carr 212 313 5.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058109
SMART Domains Protein: ENSMUSP00000053033
Gene: ENSMUSG00000046756

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:Ribosomal_S7 68 234 7.1e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106506
AA Change: I62N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102115
Gene: ENSMUSG00000020743
AA Change: I62N

DomainStartEndE-ValueType
Pfam:MIF4G 4 186 1.1e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106507
AA Change: I62N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102116
Gene: ENSMUSG00000020743
AA Change: I62N

DomainStartEndE-ValueType
Pfam:MIF4G 4 204 3.5e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137304
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146244
Predicted Effect probably damaging
Transcript: ENSMUST00000148574
AA Change: I62N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119643
Gene: ENSMUSG00000020743
AA Change: I62N

DomainStartEndE-ValueType
Pfam:MIF4G 4 162 1.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178003
SMART Domains Protein: ENSMUSP00000137534
Gene: ENSMUSG00000020744

DomainStartEndE-ValueType
Pfam:Mito_carr 11 111 1.1e-21 PFAM
Pfam:Mito_carr 114 205 7e-25 PFAM
Pfam:Mito_carr 212 313 1e-24 PFAM
Meta Mutation Damage Score 0.9133 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which interacts with the N-terminus of the stem-loop binding protein (SLBP) and the 3' end of histone mRNA. This interaction facilitates the activation of histone mRNA translation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 79,997,867 probably null Het
Abcb4 A T 5: 8,947,328 I936F probably benign Het
Adnp2 G T 18: 80,128,648 L849I probably benign Het
Atf7ip T C 6: 136,599,694 S1032P probably benign Het
Atr A C 9: 95,865,667 D334A probably benign Het
Atrip A T 9: 109,060,279 D20E probably damaging Het
Atxn7 T A 14: 14,096,268 C43* probably null Het
Cfap65 C A 1: 74,904,056 Q1603H possibly damaging Het
Cpne5 T C 17: 29,164,713 I327V probably benign Het
Ctsa T C 2: 164,834,150 S41P possibly damaging Het
Cyp4x1 A T 4: 115,108,797 L444Q probably damaging Het
Dchs1 C A 7: 105,756,041 M2431I probably benign Het
Ddi1 T A 9: 6,266,003 H122L probably benign Het
Defa21 C T 8: 21,025,648 P21S probably damaging Het
Ect2 A G 3: 27,147,000 V77A probably damaging Het
Ermap C A 4: 119,188,248 probably benign Het
Fancm G A 12: 65,118,441 probably null Het
Gcnt3 T A 9: 70,034,230 D352V probably damaging Het
Gys2 A G 6: 142,449,455 M428T possibly damaging Het
Igtp T A 11: 58,206,682 N226K probably damaging Het
Itpr2 T A 6: 146,241,196 H1675L probably benign Het
Lipo4 G A 19: 33,499,247 P367L possibly damaging Het
Lzts3 T C 2: 130,634,766 *587W probably null Het
Mast3 T A 8: 70,780,607 K300* probably null Het
Mepce G A 5: 137,785,272 T264I possibly damaging Het
Olfr307 C T 7: 86,335,644 V251I probably benign Het
Olfr869 T A 9: 20,138,087 *324K probably null Het
Palm3 A G 8: 84,029,386 K509R probably benign Het
Pde11a T C 2: 76,029,303 T821A probably damaging Het
Pik3r5 A G 11: 68,493,261 probably benign Het
Pkhd1 T C 1: 20,200,868 T3154A probably benign Het
Ptprs A G 17: 56,425,534 Y438H probably damaging Het
Rdh8 T A 9: 20,822,729 D70E probably benign Het
Scn2a A T 2: 65,713,767 I831L possibly damaging Het
Selenoo A G 15: 89,096,718 H420R probably benign Het
Slc22a16 T C 10: 40,570,681 probably benign Het
Slc5a1 A G 5: 33,145,288 T208A probably benign Het
Sparc T C 11: 55,405,236 M121V probably benign Het
Sstr1 G T 12: 58,213,631 A347S probably benign Het
Stab1 C A 14: 31,157,445 V693F probably benign Het
Tnn A G 1: 160,145,111 V307A probably benign Het
Trmt1 A G 8: 84,690,753 probably benign Het
Ttc3 T C 16: 94,442,901 S1255P probably benign Het
Ube2ql1 A C 13: 69,739,157 S62A unknown Het
Vmn2r84 T A 10: 130,385,940 M804L probably damaging Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Vps50 A G 6: 3,562,306 E467G probably damaging Het
Other mutations in Mif4gd
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0135:Mif4gd UTSW 11 115608465 missense probably damaging 1.00
R4430:Mif4gd UTSW 11 115608502 missense probably benign
R4656:Mif4gd UTSW 11 115608337 unclassified probably benign
R4947:Mif4gd UTSW 11 115609637 missense probably benign 0.01
R5890:Mif4gd UTSW 11 115609362 missense probably benign 0.03
R5935:Mif4gd UTSW 11 115609613 missense probably benign 0.18
R6527:Mif4gd UTSW 11 115609275 splice site probably null
R7106:Mif4gd UTSW 11 115611911 missense probably damaging 1.00
R7515:Mif4gd UTSW 11 115608396 missense possibly damaging 0.50
R8463:Mif4gd UTSW 11 115608498 missense probably benign 0.02
X0067:Mif4gd UTSW 11 115609584 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGTGACATAGCAGACCCAG -3'
(R):5'- TTCAATCCTTAGCAGACAGAGG -3'

Sequencing Primer
(F):5'- AGCATGCTCGGAGCTGCTC -3'
(R):5'- TCCTTAGCAGACAGAGGCAAATG -3'
Posted On2015-09-24