Incidental Mutation 'R4588:Selenoo'
ID342634
Institutional Source Beutler Lab
Gene Symbol Selenoo
Ensembl Gene ENSMUSG00000035757
Gene Nameselenoprotein O
SynonymsSelo, 1300018J18Rik
MMRRC Submission 042007-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R4588 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location89089084-89100340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89096718 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 420 (H420R)
Ref Sequence ENSEMBL: ENSMUSP00000081020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041656] [ENSMUST00000082439] [ENSMUST00000109353] [ENSMUST00000130700] [ENSMUST00000166480]
Predicted Effect probably benign
Transcript: ENSMUST00000041656
SMART Domains Protein: ENSMUSP00000040132
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1667 3.3e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000082439
AA Change: H420R

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000081020
Gene: ENSMUSG00000035757
AA Change: H420R

DomainStartEndE-ValueType
low complexity region 24 38 N/A INTRINSIC
Pfam:UPF0061 79 625 8.3e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109353
SMART Domains Protein: ENSMUSP00000104977
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 355 1675 2.8e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130700
SMART Domains Protein: ENSMUSP00000138382
Gene: ENSMUSG00000035757

DomainStartEndE-ValueType
low complexity region 24 38 N/A INTRINSIC
Pfam:UPF0061 80 241 1.5e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163290
SMART Domains Protein: ENSMUSP00000131359
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 91 288 2.9e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164717
Predicted Effect probably benign
Transcript: ENSMUST00000166480
SMART Domains Protein: ENSMUSP00000132108
Gene: ENSMUSG00000051786

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 2 123 5e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168256
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169208
Predicted Effect probably benign
Transcript: ENSMUST00000170877
Meta Mutation Damage Score 0.0596 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: This gene encodes a selenoprotein that is localized to the mitochondria. It is the largest mammalian selenoprotein, containing the rare amino acid selenocysteine (Sec). Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. The exact function of this selenoprotein is not known, but it is thought to have redox activity. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 79,997,867 probably null Het
Abcb4 A T 5: 8,947,328 I936F probably benign Het
Adnp2 G T 18: 80,128,648 L849I probably benign Het
Atf7ip T C 6: 136,599,694 S1032P probably benign Het
Atr A C 9: 95,865,667 D334A probably benign Het
Atrip A T 9: 109,060,279 D20E probably damaging Het
Atxn7 T A 14: 14,096,268 C43* probably null Het
Cfap65 C A 1: 74,904,056 Q1603H possibly damaging Het
Cpne5 T C 17: 29,164,713 I327V probably benign Het
Ctsa T C 2: 164,834,150 S41P possibly damaging Het
Cyp4x1 A T 4: 115,108,797 L444Q probably damaging Het
Dchs1 C A 7: 105,756,041 M2431I probably benign Het
Ddi1 T A 9: 6,266,003 H122L probably benign Het
Defa21 C T 8: 21,025,648 P21S probably damaging Het
Ect2 A G 3: 27,147,000 V77A probably damaging Het
Ermap C A 4: 119,188,248 probably benign Het
Fancm G A 12: 65,118,441 probably null Het
Gcnt3 T A 9: 70,034,230 D352V probably damaging Het
Gys2 A G 6: 142,449,455 M428T possibly damaging Het
Igtp T A 11: 58,206,682 N226K probably damaging Het
Itpr2 T A 6: 146,241,196 H1675L probably benign Het
Lipo4 G A 19: 33,499,247 P367L possibly damaging Het
Lzts3 T C 2: 130,634,766 *587W probably null Het
Mast3 T A 8: 70,780,607 K300* probably null Het
Mepce G A 5: 137,785,272 T264I possibly damaging Het
Mif4gd A T 11: 115,609,546 I62N probably damaging Het
Olfr307 C T 7: 86,335,644 V251I probably benign Het
Olfr869 T A 9: 20,138,087 *324K probably null Het
Palm3 A G 8: 84,029,386 K509R probably benign Het
Pde11a T C 2: 76,029,303 T821A probably damaging Het
Pik3r5 A G 11: 68,493,261 probably benign Het
Pkhd1 T C 1: 20,200,868 T3154A probably benign Het
Ptprs A G 17: 56,425,534 Y438H probably damaging Het
Rdh8 T A 9: 20,822,729 D70E probably benign Het
Scn2a A T 2: 65,713,767 I831L possibly damaging Het
Slc22a16 T C 10: 40,570,681 probably benign Het
Slc5a1 A G 5: 33,145,288 T208A probably benign Het
Sparc T C 11: 55,405,236 M121V probably benign Het
Sstr1 G T 12: 58,213,631 A347S probably benign Het
Stab1 C A 14: 31,157,445 V693F probably benign Het
Tnn A G 1: 160,145,111 V307A probably benign Het
Trmt1 A G 8: 84,690,753 probably benign Het
Ttc3 T C 16: 94,442,901 S1255P probably benign Het
Ube2ql1 A C 13: 69,739,157 S62A unknown Het
Vmn2r84 T A 10: 130,385,940 M804L probably damaging Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Vps50 A G 6: 3,562,306 E467G probably damaging Het
Other mutations in Selenoo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Selenoo APN 15 89095672 missense probably damaging 1.00
IGL01922:Selenoo APN 15 89099649 missense probably benign 0.06
IGL02103:Selenoo APN 15 89099970 missense probably damaging 1.00
R0655:Selenoo UTSW 15 89095655 missense probably damaging 1.00
R0960:Selenoo UTSW 15 89096754 missense probably benign 0.08
R1610:Selenoo UTSW 15 89099916 missense probably benign
R2152:Selenoo UTSW 15 89099282 missense probably benign 0.01
R4177:Selenoo UTSW 15 89099459 unclassified probably benign
R4622:Selenoo UTSW 15 89095707 nonsense probably null
R4731:Selenoo UTSW 15 89099328 missense probably benign 0.00
R4926:Selenoo UTSW 15 89099678 missense probably damaging 0.98
R4934:Selenoo UTSW 15 89098767 missense probably damaging 0.98
R4999:Selenoo UTSW 15 89094184 missense probably damaging 1.00
R5000:Selenoo UTSW 15 89094184 missense probably damaging 1.00
R5033:Selenoo UTSW 15 89092766 missense probably damaging 1.00
R5120:Selenoo UTSW 15 89094305 missense possibly damaging 0.79
R6034:Selenoo UTSW 15 89099343 missense probably benign 0.00
R6034:Selenoo UTSW 15 89099343 missense probably benign 0.00
R7238:Selenoo UTSW 15 89089224 missense probably benign 0.15
R7287:Selenoo UTSW 15 89098700 missense probably benign 0.01
R7378:Selenoo UTSW 15 89089478 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- AAGGTCATCAGTCTTGCCAG -3'
(R):5'- AACTGGGGCTGCTTTCAGTG -3'

Sequencing Primer
(F):5'- TCTCTGTATGGCAGGTACGACC -3'
(R):5'- TGCCACTGAGTTTGGAGAACAC -3'
Posted On2015-09-24