Incidental Mutation 'R4588:Adnp2'
ID342638
Institutional Source Beutler Lab
Gene Symbol Adnp2
Ensembl Gene ENSMUSG00000053950
Gene NameADNP homeobox 2
SynonymsZfp508, 8430420L05Rik
MMRRC Submission 042007-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4588 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location80126311-80151482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 80128648 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Isoleucine at position 849 (L849I)
Ref Sequence ENSEMBL: ENSMUSP00000068560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066743]
Predicted Effect probably benign
Transcript: ENSMUST00000066743
AA Change: L849I

PolyPhen 2 Score 0.217 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000068560
Gene: ENSMUSG00000053950
AA Change: L849I

DomainStartEndE-ValueType
ZnF_C2H2 73 96 4.57e0 SMART
ZnF_C2H2 106 128 1.06e2 SMART
ZnF_C2H2 155 178 5.48e0 SMART
ZnF_C2H2 215 240 7.29e0 SMART
low complexity region 277 290 N/A INTRINSIC
low complexity region 298 318 N/A INTRINSIC
low complexity region 333 355 N/A INTRINSIC
low complexity region 545 567 N/A INTRINSIC
low complexity region 625 648 N/A INTRINSIC
low complexity region 656 674 N/A INTRINSIC
ZnF_C2H2 696 718 9.96e0 SMART
ZnF_C2H2 724 746 4.99e1 SMART
low complexity region 747 761 N/A INTRINSIC
ZnF_C2H2 777 798 1.93e2 SMART
ZnF_C2H2 800 823 4.34e0 SMART
ZnF_C2H2 905 928 5.81e-2 SMART
HOX 1073 1135 3.25e-4 SMART
Meta Mutation Damage Score 0.3102 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 79,997,867 probably null Het
Abcb4 A T 5: 8,947,328 I936F probably benign Het
Atf7ip T C 6: 136,599,694 S1032P probably benign Het
Atr A C 9: 95,865,667 D334A probably benign Het
Atrip A T 9: 109,060,279 D20E probably damaging Het
Atxn7 T A 14: 14,096,268 C43* probably null Het
Cfap65 C A 1: 74,904,056 Q1603H possibly damaging Het
Cpne5 T C 17: 29,164,713 I327V probably benign Het
Ctsa T C 2: 164,834,150 S41P possibly damaging Het
Cyp4x1 A T 4: 115,108,797 L444Q probably damaging Het
Dchs1 C A 7: 105,756,041 M2431I probably benign Het
Ddi1 T A 9: 6,266,003 H122L probably benign Het
Defa21 C T 8: 21,025,648 P21S probably damaging Het
Ect2 A G 3: 27,147,000 V77A probably damaging Het
Ermap C A 4: 119,188,248 probably benign Het
Fancm G A 12: 65,118,441 probably null Het
Gcnt3 T A 9: 70,034,230 D352V probably damaging Het
Gys2 A G 6: 142,449,455 M428T possibly damaging Het
Igtp T A 11: 58,206,682 N226K probably damaging Het
Itpr2 T A 6: 146,241,196 H1675L probably benign Het
Lipo4 G A 19: 33,499,247 P367L possibly damaging Het
Lzts3 T C 2: 130,634,766 *587W probably null Het
Mast3 T A 8: 70,780,607 K300* probably null Het
Mepce G A 5: 137,785,272 T264I possibly damaging Het
Mif4gd A T 11: 115,609,546 I62N probably damaging Het
Olfr307 C T 7: 86,335,644 V251I probably benign Het
Olfr869 T A 9: 20,138,087 *324K probably null Het
Palm3 A G 8: 84,029,386 K509R probably benign Het
Pde11a T C 2: 76,029,303 T821A probably damaging Het
Pik3r5 A G 11: 68,493,261 probably benign Het
Pkhd1 T C 1: 20,200,868 T3154A probably benign Het
Ptprs A G 17: 56,425,534 Y438H probably damaging Het
Rdh8 T A 9: 20,822,729 D70E probably benign Het
Scn2a A T 2: 65,713,767 I831L possibly damaging Het
Selenoo A G 15: 89,096,718 H420R probably benign Het
Slc22a16 T C 10: 40,570,681 probably benign Het
Slc5a1 A G 5: 33,145,288 T208A probably benign Het
Sparc T C 11: 55,405,236 M121V probably benign Het
Sstr1 G T 12: 58,213,631 A347S probably benign Het
Stab1 C A 14: 31,157,445 V693F probably benign Het
Tnn A G 1: 160,145,111 V307A probably benign Het
Trmt1 A G 8: 84,690,753 probably benign Het
Ttc3 T C 16: 94,442,901 S1255P probably benign Het
Ube2ql1 A C 13: 69,739,157 S62A unknown Het
Vmn2r84 T A 10: 130,385,940 M804L probably damaging Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Vps50 A G 6: 3,562,306 E467G probably damaging Het
Other mutations in Adnp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00546:Adnp2 APN 18 80128867 missense probably benign 0.00
IGL00730:Adnp2 APN 18 80128032 missense probably benign
IGL01615:Adnp2 APN 18 80128477 missense probably damaging 1.00
IGL01681:Adnp2 APN 18 80127888 missense probably damaging 1.00
IGL02549:Adnp2 APN 18 80129118 missense probably damaging 1.00
R0003:Adnp2 UTSW 18 80130990 missense probably damaging 1.00
R0003:Adnp2 UTSW 18 80130990 missense probably damaging 1.00
R0013:Adnp2 UTSW 18 80129745 missense probably damaging 0.99
R0013:Adnp2 UTSW 18 80129745 missense probably damaging 0.99
R0325:Adnp2 UTSW 18 80130653 missense probably benign 0.06
R0478:Adnp2 UTSW 18 80129334 missense probably benign 0.31
R0545:Adnp2 UTSW 18 80129401 missense probably benign 0.31
R0788:Adnp2 UTSW 18 80130004 missense probably benign
R1756:Adnp2 UTSW 18 80127697 makesense probably null
R2043:Adnp2 UTSW 18 80128326 missense probably damaging 1.00
R2121:Adnp2 UTSW 18 80129170 missense probably benign 0.00
R2260:Adnp2 UTSW 18 80128449 missense probably benign 0.01
R2374:Adnp2 UTSW 18 80130987 missense probably damaging 1.00
R3416:Adnp2 UTSW 18 80128158 missense possibly damaging 0.55
R3607:Adnp2 UTSW 18 80129069 missense probably damaging 1.00
R4012:Adnp2 UTSW 18 80130821 missense probably benign 0.01
R4260:Adnp2 UTSW 18 80137527 missense possibly damaging 0.85
R5158:Adnp2 UTSW 18 80137543 missense probably damaging 0.99
R5652:Adnp2 UTSW 18 80130850 missense probably damaging 1.00
R5717:Adnp2 UTSW 18 80128264 missense probably benign 0.13
R6743:Adnp2 UTSW 18 80128059 missense probably benign 0.00
R6786:Adnp2 UTSW 18 80129745 missense probably benign 0.03
R6903:Adnp2 UTSW 18 80130090 missense probably benign
R7105:Adnp2 UTSW 18 80128151 missense possibly damaging 0.94
R7507:Adnp2 UTSW 18 80130853 missense probably benign 0.22
R7620:Adnp2 UTSW 18 80130487 missense probably damaging 1.00
R7914:Adnp2 UTSW 18 80130841 missense probably damaging 0.96
R7991:Adnp2 UTSW 18 80129322 missense probably damaging 0.97
R8290:Adnp2 UTSW 18 80142733 missense probably damaging 1.00
R8366:Adnp2 UTSW 18 80130510 missense probably damaging 1.00
R8712:Adnp2 UTSW 18 80130970 missense probably damaging 1.00
R8742:Adnp2 UTSW 18 80128341 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCAAACAAAATGGGCAGGTC -3'
(R):5'- CGCTGCCTGTCTTGTAAGTG -3'

Sequencing Primer
(F):5'- AATGGGCAGGTCAGCTTC -3'
(R):5'- TAAGTGCCTGGTCTCGCAG -3'
Posted On2015-09-24