Incidental Mutation 'R4588:Lipo4'
ID342640
Institutional Source Beutler Lab
Gene Symbol Lipo4
Ensembl Gene ENSMUSG00000079344
Gene Namelipase, member O4
SynonymsGm6857
MMRRC Submission 042007-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R4588 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location33498037-33517780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 33499247 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 367 (P367L)
Ref Sequence ENSEMBL: ENSMUSP00000108130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112511]
Predicted Effect possibly damaging
Transcript: ENSMUST00000112511
AA Change: P367L

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000108130
Gene: ENSMUSG00000079344
AA Change: P367L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Abhydro_lipase 35 97 3e-24 PFAM
Pfam:Hydrolase_4 74 239 4.7e-8 PFAM
Pfam:Abhydrolase_1 78 214 2.5e-16 PFAM
Pfam:Abhydrolase_5 78 372 1.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143522
SMART Domains Protein: ENSMUSP00000121321
Gene: ENSMUSG00000079344

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Abhydro_lipase 37 99 1.3e-24 PFAM
Pfam:Hydrolase_4 76 241 7.1e-9 PFAM
Pfam:Abhydrolase_1 80 214 8.8e-17 PFAM
Pfam:Abhydrolase_5 80 235 1.5e-8 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 79,997,867 probably null Het
Abcb4 A T 5: 8,947,328 I936F probably benign Het
Adnp2 G T 18: 80,128,648 L849I probably benign Het
Atf7ip T C 6: 136,599,694 S1032P probably benign Het
Atr A C 9: 95,865,667 D334A probably benign Het
Atrip A T 9: 109,060,279 D20E probably damaging Het
Atxn7 T A 14: 14,096,268 C43* probably null Het
Cfap65 C A 1: 74,904,056 Q1603H possibly damaging Het
Cpne5 T C 17: 29,164,713 I327V probably benign Het
Ctsa T C 2: 164,834,150 S41P possibly damaging Het
Cyp4x1 A T 4: 115,108,797 L444Q probably damaging Het
Dchs1 C A 7: 105,756,041 M2431I probably benign Het
Ddi1 T A 9: 6,266,003 H122L probably benign Het
Defa21 C T 8: 21,025,648 P21S probably damaging Het
Ect2 A G 3: 27,147,000 V77A probably damaging Het
Ermap C A 4: 119,188,248 probably benign Het
Fancm G A 12: 65,118,441 probably null Het
Gcnt3 T A 9: 70,034,230 D352V probably damaging Het
Gys2 A G 6: 142,449,455 M428T possibly damaging Het
Igtp T A 11: 58,206,682 N226K probably damaging Het
Itpr2 T A 6: 146,241,196 H1675L probably benign Het
Lzts3 T C 2: 130,634,766 *587W probably null Het
Mast3 T A 8: 70,780,607 K300* probably null Het
Mepce G A 5: 137,785,272 T264I possibly damaging Het
Mif4gd A T 11: 115,609,546 I62N probably damaging Het
Olfr307 C T 7: 86,335,644 V251I probably benign Het
Olfr869 T A 9: 20,138,087 *324K probably null Het
Palm3 A G 8: 84,029,386 K509R probably benign Het
Pde11a T C 2: 76,029,303 T821A probably damaging Het
Pik3r5 A G 11: 68,493,261 probably benign Het
Pkhd1 T C 1: 20,200,868 T3154A probably benign Het
Ptprs A G 17: 56,425,534 Y438H probably damaging Het
Rdh8 T A 9: 20,822,729 D70E probably benign Het
Scn2a A T 2: 65,713,767 I831L possibly damaging Het
Selenoo A G 15: 89,096,718 H420R probably benign Het
Slc22a16 T C 10: 40,570,681 probably benign Het
Slc5a1 A G 5: 33,145,288 T208A probably benign Het
Sparc T C 11: 55,405,236 M121V probably benign Het
Sstr1 G T 12: 58,213,631 A347S probably benign Het
Stab1 C A 14: 31,157,445 V693F probably benign Het
Tnn A G 1: 160,145,111 V307A probably benign Het
Trmt1 A G 8: 84,690,753 probably benign Het
Ttc3 T C 16: 94,442,901 S1255P probably benign Het
Ube2ql1 A C 13: 69,739,157 S62A unknown Het
Vmn2r84 T A 10: 130,385,940 M804L probably damaging Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Vps50 A G 6: 3,562,306 E467G probably damaging Het
Other mutations in Lipo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00536:Lipo4 APN 19 33515686 missense probably damaging 1.00
IGL01609:Lipo4 APN 19 33499254 missense probably benign 0.01
IGL01731:Lipo4 APN 19 33512613 missense probably damaging 1.00
R0134:Lipo4 UTSW 19 33501606 missense probably benign 0.02
R0225:Lipo4 UTSW 19 33501606 missense probably benign 0.02
R1155:Lipo4 UTSW 19 33503195 missense probably benign
R1381:Lipo4 UTSW 19 33499341 missense probably benign 0.02
R1460:Lipo4 UTSW 19 33499318 missense probably benign
R1607:Lipo4 UTSW 19 33512673 missense probably damaging 1.00
R1777:Lipo4 UTSW 19 33499321 missense probably damaging 1.00
R1919:Lipo4 UTSW 19 33499271 missense possibly damaging 0.66
R1998:Lipo4 UTSW 19 33514301 missense probably damaging 0.98
R2088:Lipo4 UTSW 19 33500069 missense possibly damaging 0.95
R2112:Lipo4 UTSW 19 33511526 missense probably benign 0.07
R3931:Lipo4 UTSW 19 33503219 missense probably benign
R4869:Lipo4 UTSW 19 33501553 critical splice donor site probably null
R5406:Lipo4 UTSW 19 33503218 missense probably benign 0.00
R5640:Lipo4 UTSW 19 33501586 missense possibly damaging 0.92
R6160:Lipo4 UTSW 19 33503293 missense probably damaging 0.99
R6957:Lipo4 UTSW 19 33499367 missense probably benign 0.30
R7403:Lipo4 UTSW 19 33503279 missense possibly damaging 0.91
R7816:Lipo4 UTSW 19 33514242 missense probably damaging 1.00
R7847:Lipo4 UTSW 19 33514199 missense possibly damaging 0.95
R7868:Lipo4 UTSW 19 33511568 missense possibly damaging 0.68
R7890:Lipo4 UTSW 19 33501564 missense probably damaging 1.00
R7975:Lipo4 UTSW 19 33512628 missense probably damaging 1.00
R8391:Lipo4 UTSW 19 33511565 missense probably benign 0.02
X0028:Lipo4 UTSW 19 33503288 frame shift probably null
Z1176:Lipo4 UTSW 19 33503184 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCCAAGCAAGAAAACATTTGC -3'
(R):5'- CCAAGCTCAATGATTTCTATGGAC -3'

Sequencing Primer
(F):5'- TGCACTTATAAGAACAAGAGACTTTC -3'
(R):5'- AATGTTTTGTTAACGCATTGCTC -3'
Posted On2015-09-24