Incidental Mutation 'R0346:Washc2'
ID34265
Institutional Source Beutler Lab
Gene Symbol Washc2
Ensembl Gene ENSMUSG00000024104
Gene NameWASH complex subunit 2`
SynonymsFam21, D6Wsu116e, C530005J20Rik
MMRRC Submission 038553-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0346 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location116208038-116262686 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 116220523 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036759] [ENSMUST00000203286] [ENSMUST00000203523] [ENSMUST00000203928] [ENSMUST00000204283] [ENSMUST00000204476]
Predicted Effect probably benign
Transcript: ENSMUST00000036759
SMART Domains Protein: ENSMUSP00000038983
Gene: ENSMUSG00000024104

DomainStartEndE-ValueType
coiled coil region 95 129 N/A INTRINSIC
low complexity region 196 213 N/A INTRINSIC
low complexity region 216 238 N/A INTRINSIC
low complexity region 262 276 N/A INTRINSIC
low complexity region 443 455 N/A INTRINSIC
low complexity region 531 561 N/A INTRINSIC
low complexity region 660 668 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
Pfam:CAP-ZIP_m 939 1074 4.3e-58 PFAM
low complexity region 1268 1282 N/A INTRINSIC
low complexity region 1297 1317 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203161
Predicted Effect probably benign
Transcript: ENSMUST00000203286
Predicted Effect probably benign
Transcript: ENSMUST00000203523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203802
Predicted Effect probably benign
Transcript: ENSMUST00000203928
Predicted Effect probably benign
Transcript: ENSMUST00000204283
SMART Domains Protein: ENSMUSP00000144703
Gene: ENSMUSG00000024104

DomainStartEndE-ValueType
coiled coil region 9 43 N/A INTRINSIC
low complexity region 110 127 N/A INTRINSIC
low complexity region 130 152 N/A INTRINSIC
low complexity region 176 190 N/A INTRINSIC
low complexity region 357 369 N/A INTRINSIC
low complexity region 445 475 N/A INTRINSIC
low complexity region 574 582 N/A INTRINSIC
low complexity region 715 724 N/A INTRINSIC
Pfam:CAP-ZIP_m 853 988 2.8e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204476
SMART Domains Protein: ENSMUSP00000144982
Gene: ENSMUSG00000024104

DomainStartEndE-ValueType
coiled coil region 95 129 N/A INTRINSIC
low complexity region 196 213 N/A INTRINSIC
low complexity region 216 238 N/A INTRINSIC
low complexity region 262 276 N/A INTRINSIC
low complexity region 443 455 N/A INTRINSIC
low complexity region 531 561 N/A INTRINSIC
low complexity region 660 668 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.4%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,566,278 I4406L probably damaging Het
Abca16 T A 7: 120,435,932 C314S probably damaging Het
Add3 C T 19: 53,216,956 R46* probably null Het
Alas1 A T 9: 106,243,351 S82T possibly damaging Het
Alkbh5 C G 11: 60,538,741 R107G possibly damaging Het
Ap3b1 A T 13: 94,445,971 R365* probably null Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
AU021092 T C 16: 5,216,854 D168G possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Caln1 C A 5: 130,822,921 H184N possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Ccdc191 T C 16: 43,938,952 V372A probably damaging Het
Ccng2 T G 5: 93,270,894 I126S probably damaging Het
Cep85 A T 4: 134,132,422 N643K probably damaging Het
Clvs2 G C 10: 33,622,546 S129R possibly damaging Het
Cntn1 G T 15: 92,232,087 probably benign Het
Cttn A T 7: 144,452,539 probably benign Het
Dedd2 T C 7: 25,211,269 S161G possibly damaging Het
Dnajb13 T C 7: 100,503,925 D263G probably damaging Het
Dppa4 T A 16: 48,289,324 probably benign Het
Ear2 A G 14: 44,102,906 E7G probably damaging Het
Eif2b4 A G 5: 31,188,108 probably benign Het
Etl4 G T 2: 20,759,652 probably null Het
Fbxo15 T A 18: 84,960,221 probably null Het
Gm8765 T C 13: 50,703,310 Y995H probably benign Het
Gm9970 A G 5: 31,240,838 probably benign Het
Hap1 A G 11: 100,356,029 S17P probably benign Het
Hgd C T 16: 37,588,774 probably benign Het
Inpp5f T A 7: 128,690,668 L16Q probably damaging Het
Islr2 G A 9: 58,198,343 R545* probably null Het
Itgav G T 2: 83,792,609 C675F probably damaging Het
Kif13a T A 13: 46,814,219 I403L possibly damaging Het
Kif14 T A 1: 136,468,160 I68N probably damaging Het
Kif26a G T 12: 112,179,348 K1764N probably null Het
Lrrd1 C A 5: 3,850,215 F173L probably benign Het
Mroh4 G C 15: 74,614,292 probably benign Het
Mrvi1 T C 7: 110,898,976 D404G probably damaging Het
Msh5 A G 17: 35,029,888 V723A probably benign Het
Mybph T G 1: 134,197,754 I279S probably damaging Het
Myh4 A T 11: 67,260,326 I1936L probably benign Het
Myo1h A T 5: 114,355,209 T704S probably benign Het
Nav2 C A 7: 49,604,585 T2377K probably benign Het
Nipbl T G 15: 8,360,956 Q276H probably damaging Het
Nlrp9b T C 7: 20,024,515 L559P probably damaging Het
Nup210l T A 3: 90,189,438 V1318E probably damaging Het
Olfr1427 A T 19: 12,099,439 S67T probably damaging Het
Olfr18 A G 9: 20,314,411 S170P probably benign Het
Olfr385 A G 11: 73,589,457 Y94H probably damaging Het
Olfr765 C A 10: 129,046,473 V197F possibly damaging Het
P2ry13 T C 3: 59,209,566 T264A possibly damaging Het
Plekhg5 T C 4: 152,114,253 L966P probably benign Het
Prss35 A G 9: 86,755,351 K58R probably benign Het
Ptafr T A 4: 132,580,079 L260* probably null Het
Pum1 A T 4: 130,779,805 T1157S possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf145 A G 11: 44,555,164 Y275C probably damaging Het
Rpl6 A T 5: 121,208,491 K218N possibly damaging Het
Rps6 T C 4: 86,855,981 T128A probably benign Het
Ryr1 G T 7: 29,067,588 probably benign Het
Scel A T 14: 103,529,984 Q26H probably damaging Het
Sfxn4 A T 19: 60,858,673 D57E probably benign Het
Slc35d1 A C 4: 103,190,847 L240R probably damaging Het
Smcr8 A G 11: 60,779,750 I575V probably benign Het
Syk G A 13: 52,640,659 M476I probably damaging Het
Tbcel A T 9: 42,437,243 probably benign Het
Tob2 C A 15: 81,858,223 G65W probably damaging Het
Trim16 A G 11: 62,840,694 N464D probably benign Het
Trim36 T C 18: 46,199,709 probably benign Het
Trpv4 C A 5: 114,630,529 probably benign Het
Tsga10 T A 1: 37,840,519 T64S possibly damaging Het
Ttc26 T C 6: 38,409,435 C364R probably damaging Het
Vars2 A T 17: 35,664,864 probably benign Het
Vmn1r72 C A 7: 11,669,694 V276L probably benign Het
Vps13a T A 19: 16,677,969 K1898N probably benign Het
Vps18 A G 2: 119,297,164 M823V probably damaging Het
Zfp763 A T 17: 33,019,747 H141Q probably benign Het
Other mutations in Washc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Washc2 APN 6 116256676 missense probably benign
IGL00552:Washc2 APN 6 116256824 missense possibly damaging 0.85
IGL01397:Washc2 APN 6 116247998 missense probably benign 0.44
IGL01668:Washc2 APN 6 116262338 missense probably damaging 1.00
IGL01982:Washc2 APN 6 116236189 missense probably benign 0.22
IGL02022:Washc2 APN 6 116259165 missense probably benign 0.22
IGL02150:Washc2 APN 6 116231632 splice site probably benign
IGL02224:Washc2 APN 6 116220569 missense possibly damaging 0.70
IGL02553:Washc2 APN 6 116241610 missense probably damaging 0.98
IGL02555:Washc2 APN 6 116209100 missense probably damaging 1.00
IGL02612:Washc2 APN 6 116220616 missense possibly damaging 0.90
IGL02622:Washc2 APN 6 116214018 splice site probably benign
IGL02900:Washc2 APN 6 116227474 missense probably damaging 1.00
IGL03263:Washc2 APN 6 116238123 splice site probably benign
fading UTSW 6 116254153 missense probably damaging 1.00
R0218:Washc2 UTSW 6 116248046 nonsense probably null
R0285:Washc2 UTSW 6 116221839 missense probably damaging 1.00
R0677:Washc2 UTSW 6 116244616 missense probably damaging 1.00
R0919:Washc2 UTSW 6 116208264 missense probably damaging 1.00
R1144:Washc2 UTSW 6 116224534 missense probably damaging 1.00
R1666:Washc2 UTSW 6 116223254 critical splice donor site probably null
R1687:Washc2 UTSW 6 116256712 missense probably benign 0.06
R1702:Washc2 UTSW 6 116229306 missense probably damaging 0.99
R1740:Washc2 UTSW 6 116231632 splice site probably benign
R1952:Washc2 UTSW 6 116255091 missense possibly damaging 0.92
R1964:Washc2 UTSW 6 116208987 missense probably damaging 0.99
R2039:Washc2 UTSW 6 116224439 missense probably damaging 0.99
R3084:Washc2 UTSW 6 116227493 missense probably benign 0.00
R3552:Washc2 UTSW 6 116220568 missense probably damaging 1.00
R3790:Washc2 UTSW 6 116247972 splice site probably benign
R3949:Washc2 UTSW 6 116208204 utr 5 prime probably benign
R4089:Washc2 UTSW 6 116256292 splice site probably null
R4133:Washc2 UTSW 6 116258930 missense probably damaging 0.99
R4258:Washc2 UTSW 6 116208241 missense probably damaging 1.00
R4510:Washc2 UTSW 6 116220556 missense probably damaging 1.00
R4511:Washc2 UTSW 6 116220556 missense probably damaging 1.00
R4613:Washc2 UTSW 6 116229269 missense probably damaging 1.00
R4614:Washc2 UTSW 6 116238174 missense possibly damaging 0.83
R4794:Washc2 UTSW 6 116258649 missense probably benign 0.03
R5224:Washc2 UTSW 6 116209004 makesense probably null
R5367:Washc2 UTSW 6 116259150 missense probably damaging 1.00
R5602:Washc2 UTSW 6 116248095 missense possibly damaging 0.73
R6013:Washc2 UTSW 6 116254153 missense probably damaging 1.00
R6075:Washc2 UTSW 6 116227366 missense probably benign 0.02
R6086:Washc2 UTSW 6 116256216 splice site probably null
R6344:Washc2 UTSW 6 116258758 missense probably benign 0.08
R6593:Washc2 UTSW 6 116259249 missense probably damaging 1.00
R7048:Washc2 UTSW 6 116220583 missense possibly damaging 0.96
R7062:Washc2 UTSW 6 116219988 missense possibly damaging 0.72
R7241:Washc2 UTSW 6 116208207 start codon destroyed probably null 0.01
R7283:Washc2 UTSW 6 116227418 missense probably damaging 0.99
R7681:Washc2 UTSW 6 116260657 missense probably damaging 0.99
R7810:Washc2 UTSW 6 116259059 missense probably benign
R7908:Washc2 UTSW 6 116248145 missense probably benign
R7989:Washc2 UTSW 6 116248145 missense probably benign
X0018:Washc2 UTSW 6 116208258 missense probably null 0.96
Predicted Primers PCR Primer
(F):5'- AGCGCATGTATTGCACTGACTCC -3'
(R):5'- CCGTTTACCTCTGGCTACACACAAAAG -3'

Sequencing Primer
(F):5'- ATGGTATTTGTATGCCAAGTCTCC -3'
(R):5'- TGGCTACACACAAAAGTAAAGTGTC -3'
Posted On2013-05-09