Incidental Mutation 'R4589:Pak6'
ID342655
Institutional Source Beutler Lab
Gene Symbol Pak6
Ensembl Gene ENSMUSG00000074923
Gene Namep21 (RAC1) activated kinase 6
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4589 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location118663303-118698020 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118696540 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 672 (I672K)
Ref Sequence ENSEMBL: ENSMUSP00000106477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099557] [ENSMUST00000104937] [ENSMUST00000110853]
Predicted Effect probably damaging
Transcript: ENSMUST00000099557
AA Change: I672K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097153
Gene: ENSMUSG00000074923
AA Change: I672K

DomainStartEndE-ValueType
PBD 12 47 4.47e-11 SMART
S_TKc 408 659 2.38e-89 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000104937
SMART Domains Protein: ENSMUSP00000100542
Gene: ENSMUSG00000078137

DomainStartEndE-ValueType
ANK 46 79 1.87e0 SMART
ANK 83 112 3.23e-4 SMART
ANK 116 145 3.44e1 SMART
low complexity region 193 247 N/A INTRINSIC
low complexity region 331 341 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110853
AA Change: I672K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106477
Gene: ENSMUSG00000074923
AA Change: I672K

DomainStartEndE-ValueType
PBD 12 47 4.47e-11 SMART
S_TKc 408 659 2.38e-89 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132577
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of p21-stimulated serine/threonine protein kinases, which contain an amino-terminal Cdc42/Rac interactive binding (CRIB) domain and a carboxyl-terminal kinase domain. These kinases function in a number of cellular processes, including cytoskeleton rearrangement, apoptosis, and the mitogen-activated protein (MAP) kinase signaling pathway. The protein encoded by this gene interacts with androgen receptor (AR) and translocates to the nucleus, where it is involved in transcriptional regulation. Changes in expression of this gene have been linked to prostate cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a null allele do not exhibit any abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,773,582 S223P probably damaging Het
Abcc1 G T 16: 14,394,031 V157L probably benign Het
Actn1 G A 12: 80,171,799 T737I possibly damaging Het
Ada T C 2: 163,732,948 K90E possibly damaging Het
Ap2b1 T A 11: 83,333,011 L184* probably null Het
Arfgef3 T C 10: 18,646,199 D693G probably damaging Het
Arid4a A T 12: 71,069,964 I277F probably damaging Het
BC003331 C T 1: 150,384,487 V127I probably benign Het
Ccdc171 A G 4: 83,549,618 S67G probably benign Het
Ccr5 T A 9: 124,124,502 F47L probably benign Het
Clip4 T A 17: 71,810,867 C302* probably null Het
Cyth1 C T 11: 118,184,985 V142I possibly damaging Het
Ddx59 T A 1: 136,439,742 probably null Het
Def6 G T 17: 28,228,147 R584L probably benign Het
Dnah7c C A 1: 46,514,583 Y340* probably null Het
Eif2ak4 T G 2: 118,417,338 C173W probably damaging Het
Gm14403 C T 2: 177,508,635 H125Y probably benign Het
Grk3 T C 5: 112,941,718 I323V possibly damaging Het
Homez G T 14: 54,857,030 T407K probably damaging Het
Igdcc4 A G 9: 65,130,628 T763A probably damaging Het
Ighg2b A T 12: 113,306,484 W305R unknown Het
Il27ra G T 8: 84,036,409 N296K probably damaging Het
Lzic G T 4: 149,488,104 L50F probably damaging Het
Mbtd1 T C 11: 93,921,419 V183A probably damaging Het
Mme T A 3: 63,380,272 D731E probably benign Het
Mocos T C 18: 24,654,038 L38P probably damaging Het
Mrps18a T C 17: 46,117,973 probably null Het
Msh2 T A 17: 87,680,032 V200D possibly damaging Het
Mug1 A T 6: 121,857,351 I364F probably benign Het
Mycbp2 G T 14: 103,177,313 S2554R probably benign Het
Nat10 A G 2: 103,754,070 C121R probably damaging Het
Nfatc3 T A 8: 106,079,073 D183E probably damaging Het
Olfr1162 T C 2: 88,050,479 I48M probably benign Het
Olfr1426 T C 19: 12,087,941 I284V possibly damaging Het
Olfr616 A T 7: 103,564,432 F282L probably damaging Het
Olfr648 C A 7: 104,179,429 probably null Het
Pan3 A T 5: 147,543,173 I830F probably damaging Het
Pcdh9 A T 14: 93,888,192 L181I probably damaging Het
Pigg G A 5: 108,332,690 A447T probably benign Het
Pitpnb T A 5: 111,371,348 S165T probably damaging Het
Pla2g2a A G 4: 138,833,279 Y67C probably damaging Het
Plch1 A G 3: 63,781,507 I80T probably damaging Het
Pnma1 A G 12: 84,147,461 I156T probably benign Het
Prss21 G T 17: 23,872,822 D255Y possibly damaging Het
Prune1 T A 3: 95,262,331 I187F possibly damaging Het
Rab7b T C 1: 131,705,647 F78L probably benign Het
Riok3 T A 18: 12,136,787 Y92N probably benign Het
Rpap2 T C 5: 107,620,495 S400P probably benign Het
Ryr3 C A 2: 112,875,133 G792V probably damaging Het
Sept3 A G 15: 82,285,891 E206G probably damaging Het
Stkld1 T C 2: 26,950,667 S454P probably damaging Het
Tdh A T 14: 63,495,877 L140Q probably damaging Het
Tex15 T A 8: 33,557,373 H159Q probably damaging Het
Tmed6 C T 8: 107,064,161 V85I probably benign Het
Vmn1r174 T A 7: 23,754,779 L290* probably null Het
Vmn1r31 A G 6: 58,472,611 S90P probably damaging Het
Vmn2r55 T C 7: 12,670,895 T194A probably damaging Het
Vmn2r82 A T 10: 79,356,714 I42F probably damaging Het
Vps35 G A 8: 85,287,702 P106L probably damaging Het
Xrcc6 T A 15: 82,022,460 Y69N probably damaging Het
Zbtb14 C T 17: 69,388,470 P388S probably damaging Het
Zfp541 C T 7: 16,083,336 A902V probably benign Het
Other mutations in Pak6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Pak6 APN 2 118689845 missense possibly damaging 0.58
IGL00979:Pak6 APN 2 118696482 missense probably damaging 1.00
IGL01577:Pak6 APN 2 118693648 missense probably benign 0.00
IGL01928:Pak6 APN 2 118689864 missense probably damaging 1.00
IGL01951:Pak6 APN 2 118693260 missense probably benign
IGL02387:Pak6 APN 2 118693233 missense probably benign
IGL03302:Pak6 APN 2 118693303 missense probably benign
bedamned UTSW 2 118694007 splice site probably benign
bequeathed UTSW 2 118693522 missense probably damaging 0.96
R0126:Pak6 UTSW 2 118690332 missense possibly damaging 0.86
R0883:Pak6 UTSW 2 118693687 missense probably damaging 1.00
R1128:Pak6 UTSW 2 118696509 missense probably benign 0.00
R2073:Pak6 UTSW 2 118688851 missense probably damaging 1.00
R2508:Pak6 UTSW 2 118694569 nonsense probably null
R2920:Pak6 UTSW 2 118694007 splice site probably benign
R3118:Pak6 UTSW 2 118689741 missense probably damaging 1.00
R3689:Pak6 UTSW 2 118693440 nonsense probably null
R3762:Pak6 UTSW 2 118696477 missense probably damaging 0.99
R4976:Pak6 UTSW 2 118694548 missense probably damaging 1.00
R5119:Pak6 UTSW 2 118694548 missense probably damaging 1.00
R5206:Pak6 UTSW 2 118693303 missense probably benign
R5683:Pak6 UTSW 2 118693912 missense probably damaging 1.00
R7232:Pak6 UTSW 2 118693522 missense probably damaging 0.96
R7236:Pak6 UTSW 2 118693428 missense probably benign 0.26
R7292:Pak6 UTSW 2 118693591 missense possibly damaging 0.95
R7623:Pak6 UTSW 2 118694587 missense probably damaging 1.00
R7823:Pak6 UTSW 2 118695312 missense probably benign 0.02
R8190:Pak6 UTSW 2 118690097 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAAGTGACTGCGAGCCATG -3'
(R):5'- CTCTGGGGAGTGAAACCAAG -3'

Sequencing Primer
(F):5'- GCCATGGCTTCCCCTCAC -3'
(R):5'- CCCAGCGGGCAAAAGGG -3'
Posted On2015-09-24