Mutagenetix > Incidental Mutations

Incidental Mutation 'R4589:Plch1'

342660

Institutional Source

Beutler Lab

Gene Symbol

Plch1

Ensembl Gene

ENSMUSG00000036834

Gene Name

phospholipase C, eta 1

Synonyms

PLCeta1, Plcl3

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.108) question?

Stock #

R4589 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

63696234-63899472 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 63781507 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 80 (I80T)

Ref Sequence

ENSEMBL: ENSMUSP00000124463 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048134] [ENSMUST00000059973] [ENSMUST00000084105] [ENSMUST00000159188] [ENSMUST00000159676] [ENSMUST00000160638] [ENSMUST00000162269] [ENSMUST00000175947] [ENSMUST00000177143]

Predicted Effect

probably damaging
Transcript: ENSMUST00000048134
AA Change: I62T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000047693
Gene: ENSMUSG00000036834
AA Change: I62T

Domain	Start	End	E-Value	Type
PH	3	112	2.37e-6	SMART
EFh	128	156	2.41e-4	SMART
EFh	164	193	1.54e-2	SMART
Pfam:EF-hand_like	198	280	2.2e-26	PFAM
PLCXc	281	426	3.13e-71	SMART
low complexity region	440	453	N/A	INTRINSIC
low complexity region	564	581	N/A	INTRINSIC
PLCYc	583	696	3.4e-49	SMART
C2	715	823	5.47e-22	SMART
low complexity region	979	997	N/A	INTRINSIC
low complexity region	1079	1091	N/A	INTRINSIC
low complexity region	1420	1435	N/A	INTRINSIC
low complexity region	1543	1557	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000059973
AA Change: I80T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000058524
Gene: ENSMUSG00000036834
AA Change: I80T

Domain	Start	End	E-Value	Type
PH	21	130	1.1e-8	SMART
EFh	146	174	1.1e-6	SMART
EFh	182	211	7.6e-5	SMART
Pfam:EF-hand_like	216	298	4.5e-24	PFAM
PLCXc	299	444	1.6e-73	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	582	599	N/A	INTRINSIC
PLCYc	601	714	1.7e-51	SMART
C2	733	841	3.7e-24	SMART
low complexity region	1017	1035	N/A	INTRINSIC
low complexity region	1117	1129	N/A	INTRINSIC
low complexity region	1458	1473	N/A	INTRINSIC
low complexity region	1581	1595	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000084105
AA Change: I80T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000081122
Gene: ENSMUSG00000036834
AA Change: I80T

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	2.4e-27	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	583	600	N/A	INTRINSIC
PLCYc	602	715	3.4e-49	SMART
C2	734	842	5.47e-22	SMART
low complexity region	1018	1036	N/A	INTRINSIC
low complexity region	1118	1130	N/A	INTRINSIC
low complexity region	1459	1474	N/A	INTRINSIC
low complexity region	1582	1596	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000159188
AA Change: I92T

PolyPhen 2 Score 0.249 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000124491
Gene: ENSMUSG00000036834
AA Change: I92T

Domain	Start	End	E-Value	Type
SCOP:d1mai__	28	135	2e-29	SMART
PDB:1MAI\|A	31	135	1e-5	PDB
Blast:PH	33	135	1e-72	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000159676
AA Change: I80T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000124632
Gene: ENSMUSG00000036834
AA Change: I80T

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	1.8e-26	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	583	600	N/A	INTRINSIC
PLCYc	602	715	3.4e-49	SMART
C2	734	842	5.47e-22	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000160638
AA Change: I80T

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000123921
Gene: ENSMUSG00000036834
AA Change: I80T

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	5.3e-28	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	583	600	N/A	INTRINSIC
PLCYc	602	715	3.4e-49	SMART
C2	734	842	5.47e-22	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000162269
AA Change: I80T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000124463
Gene: ENSMUSG00000036834
AA Change: I80T

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	1.7e-26	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	583	600	N/A	INTRINSIC
PLCYc	602	715	3.4e-49	SMART
C2	734	842	5.47e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000175947
AA Change: I80T

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000135353
Gene: ENSMUSG00000036834
AA Change: I80T

Domain	Start	End	E-Value	Type
PH	21	130	2.37e-6	SMART
EFh	146	174	2.41e-4	SMART
EFh	182	211	1.54e-2	SMART
Pfam:EF-hand_like	216	298	1.2e-26	PFAM
PLCXc	299	444	3.13e-71	SMART
low complexity region	458	471	N/A	INTRINSIC
low complexity region	582	599	N/A	INTRINSIC
PLCYc	601	714	3.4e-49	SMART
C2	733	841	5.47e-22	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000177143
AA Change: I92T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000135424
Gene: ENSMUSG00000036834
AA Change: I92T

Domain	Start	End	E-Value	Type
PH	33	142	2.37e-6	SMART
EFh	158	186	2.41e-4	SMART
EFh	194	223	1.54e-2	SMART
Pfam:EF-hand_like	228	310	2.3e-26	PFAM
PLCXc	311	456	3.13e-71	SMART
low complexity region	470	483	N/A	INTRINSIC
low complexity region	594	611	N/A	INTRINSIC
PLCYc	613	726	3.4e-49	SMART
C2	745	853	5.47e-22	SMART
low complexity region	1009	1027	N/A	INTRINSIC
low complexity region	1109	1121	N/A	INTRINSIC
low complexity region	1450	1465	N/A	INTRINSIC
low complexity region	1573	1587	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PLCH1 is a member of the PLC-eta family of the phosphoinositide-specific phospholipase C (PLC) superfamily of enzymes that cleave phosphatidylinositol 4,5-bisphosphate (PtdIns(4,5)P2) to generate second messengers inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG) (Hwang et al., 2005 [PubMed 15702972]).[supplied by OMIM, Jun 2009]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	A	G	14: 49,773,582	S223P	probably damaging	Het
Abcc1	G	T	16: 14,394,031	V157L	probably benign	Het
Actn1	G	A	12: 80,171,799	T737I	possibly damaging	Het
Ada	T	C	2: 163,732,948	K90E	possibly damaging	Het
Ap2b1	T	A	11: 83,333,011	L184*	probably null	Het
Arfgef3	T	C	10: 18,646,199	D693G	probably damaging	Het
Arid4a	A	T	12: 71,069,964	I277F	probably damaging	Het
BC003331	C	T	1: 150,384,487	V127I	probably benign	Het
Ccdc171	A	G	4: 83,549,618	S67G	probably benign	Het
Ccr5	T	A	9: 124,124,502	F47L	probably benign	Het
Clip4	T	A	17: 71,810,867	C302*	probably null	Het
Cyth1	C	T	11: 118,184,985	V142I	possibly damaging	Het
Ddx59	T	A	1: 136,439,742		probably null	Het
Def6	G	T	17: 28,228,147	R584L	probably benign	Het
Dnah7c	C	A	1: 46,514,583	Y340*	probably null	Het
Eif2ak4	T	G	2: 118,417,338	C173W	probably damaging	Het
Gm14403	C	T	2: 177,508,635	H125Y	probably benign	Het
Grk3	T	C	5: 112,941,718	I323V	possibly damaging	Het
Homez	G	T	14: 54,857,030	T407K	probably damaging	Het
Igdcc4	A	G	9: 65,130,628	T763A	probably damaging	Het
Ighg2b	A	T	12: 113,306,484	W305R	unknown	Het
Il27ra	G	T	8: 84,036,409	N296K	probably damaging	Het
Lzic	G	T	4: 149,488,104	L50F	probably damaging	Het
Mbtd1	T	C	11: 93,921,419	V183A	probably damaging	Het
Mme	T	A	3: 63,380,272	D731E	probably benign	Het
Mocos	T	C	18: 24,654,038	L38P	probably damaging	Het
Mrps18a	T	C	17: 46,117,973		probably null	Het
Msh2	T	A	17: 87,680,032	V200D	possibly damaging	Het
Mug1	A	T	6: 121,857,351	I364F	probably benign	Het
Mycbp2	G	T	14: 103,177,313	S2554R	probably benign	Het
Nat10	A	G	2: 103,754,070	C121R	probably damaging	Het
Nfatc3	T	A	8: 106,079,073	D183E	probably damaging	Het
Olfr1162	T	C	2: 88,050,479	I48M	probably benign	Het
Olfr1426	T	C	19: 12,087,941	I284V	possibly damaging	Het
Olfr616	A	T	7: 103,564,432	F282L	probably damaging	Het
Olfr648	C	A	7: 104,179,429		probably null	Het
Pak6	T	A	2: 118,696,540	I672K	probably damaging	Het
Pan3	A	T	5: 147,543,173	I830F	probably damaging	Het
Pcdh9	A	T	14: 93,888,192	L181I	probably damaging	Het
Pigg	G	A	5: 108,332,690	A447T	probably benign	Het
Pitpnb	T	A	5: 111,371,348	S165T	probably damaging	Het
Pla2g2a	A	G	4: 138,833,279	Y67C	probably damaging	Het
Pnma1	A	G	12: 84,147,461	I156T	probably benign	Het
Prss21	G	T	17: 23,872,822	D255Y	possibly damaging	Het
Prune1	T	A	3: 95,262,331	I187F	possibly damaging	Het
Rab7b	T	C	1: 131,705,647	F78L	probably benign	Het
Riok3	T	A	18: 12,136,787	Y92N	probably benign	Het
Rpap2	T	C	5: 107,620,495	S400P	probably benign	Het
Ryr3	C	A	2: 112,875,133	G792V	probably damaging	Het
Sept3	A	G	15: 82,285,891	E206G	probably damaging	Het
Stkld1	T	C	2: 26,950,667	S454P	probably damaging	Het
Tdh	A	T	14: 63,495,877	L140Q	probably damaging	Het
Tex15	T	A	8: 33,557,373	H159Q	probably damaging	Het
Tmed6	C	T	8: 107,064,161	V85I	probably benign	Het
Vmn1r174	T	A	7: 23,754,779	L290*	probably null	Het
Vmn1r31	A	G	6: 58,472,611	S90P	probably damaging	Het
Vmn2r55	T	C	7: 12,670,895	T194A	probably damaging	Het
Vmn2r82	A	T	10: 79,356,714	I42F	probably damaging	Het
Vps35	G	A	8: 85,287,702	P106L	probably damaging	Het
Xrcc6	T	A	15: 82,022,460	Y69N	probably damaging	Het
Zbtb14	C	T	17: 69,388,470	P388S	probably damaging	Het
Zfp541	C	T	7: 16,083,336	A902V	probably benign	Het

Other mutations in Plch1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01397:Plch1	APN	3	63731729	splice site	probably null
IGL01542:Plch1	APN	3	63731649	missense	probably damaging	0.99
IGL01999:Plch1	APN	3	63753307	missense	probably damaging	1.00
IGL02153:Plch1	APN	3	63781351	missense	probably damaging	1.00
IGL02203:Plch1	APN	3	63698739	missense	possibly damaging	0.46
IGL02220:Plch1	APN	3	63698961	missense	probably damaging	0.97
IGL02259:Plch1	APN	3	63722749	critical splice donor site	probably null
IGL02268:Plch1	APN	3	63699283	makesense	probably null
IGL02411:Plch1	APN	3	63697756	splice site	probably null
IGL02472:Plch1	APN	3	63701849	missense	probably damaging	1.00
IGL02477:Plch1	APN	3	63753293	missense	probably damaging	1.00
IGL02503:Plch1	APN	3	63697864	missense	probably damaging	1.00
IGL02800:Plch1	APN	3	63698478	missense	probably benign	0.21
IGL03167:Plch1	APN	3	63722744	splice site	probably benign
IGL03182:Plch1	APN	3	63702594	nonsense	probably null
IGL03197:Plch1	APN	3	63753170	missense	probably damaging	1.00
IGL03251:Plch1	APN	3	63784002	missense	possibly damaging	0.93
BB009:Plch1	UTSW	3	63701981	missense	probably benign	0.05
BB019:Plch1	UTSW	3	63701981	missense	probably benign	0.05
R0335:Plch1	UTSW	3	63710978	missense	probably damaging	1.00
R0347:Plch1	UTSW	3	63753316	missense	probably damaging	1.00
R0631:Plch1	UTSW	3	63699219	missense	probably benign	0.23
R0687:Plch1	UTSW	3	63716029	missense	probably damaging	1.00
R0738:Plch1	UTSW	3	63702553	intron	probably benign
R0883:Plch1	UTSW	3	63753256	missense	probably damaging	1.00
R1437:Plch1	UTSW	3	63697533	missense	probably benign	0.37
R1678:Plch1	UTSW	3	63740694	missense	probably damaging	1.00
R1738:Plch1	UTSW	3	63719238	missense	probably benign	0.12
R1929:Plch1	UTSW	3	63744535	missense	probably damaging	1.00
R1955:Plch1	UTSW	3	63755267	missense	probably damaging	0.98
R2078:Plch1	UTSW	3	63701943	missense	probably benign	0.01
R2112:Plch1	UTSW	3	63722806	missense	probably damaging	1.00
R2158:Plch1	UTSW	3	63721234	missense	probably benign	0.00
R2165:Plch1	UTSW	3	63698482	missense	probably benign	0.01
R2259:Plch1	UTSW	3	63697977	missense	possibly damaging	0.94
R2271:Plch1	UTSW	3	63744535	missense	probably damaging	1.00
R3110:Plch1	UTSW	3	63709531	missense	probably damaging	1.00
R3112:Plch1	UTSW	3	63709531	missense	probably damaging	1.00
R3407:Plch1	UTSW	3	63699347	unclassified	probably benign
R3408:Plch1	UTSW	3	63699347	unclassified	probably benign
R3791:Plch1	UTSW	3	63699523	missense	probably benign
R3793:Plch1	UTSW	3	63697831	missense	probably damaging	0.96
R3928:Plch1	UTSW	3	63767623	missense	probably damaging	1.00
R4211:Plch1	UTSW	3	63711219	missense	probably damaging	1.00
R4212:Plch1	UTSW	3	63870759	start gained	probably benign
R4223:Plch1	UTSW	3	63701900	missense	probably damaging	1.00
R4491:Plch1	UTSW	3	63740739	missense	probably damaging	1.00
R4656:Plch1	UTSW	3	63704177	missense	probably damaging	1.00
R4701:Plch1	UTSW	3	63699496	splice site	probably null
R4716:Plch1	UTSW	3	63781546	missense	probably damaging	1.00
R4772:Plch1	UTSW	3	63753325	missense	probably damaging	1.00
R4902:Plch1	UTSW	3	63740843	intron	probably benign
R5058:Plch1	UTSW	3	63722781	missense	probably damaging	1.00
R5092:Plch1	UTSW	3	63698710	missense	probably benign	0.02
R5093:Plch1	UTSW	3	63773715	missense	probably damaging	0.99
R5210:Plch1	UTSW	3	63699778	critical splice donor site	probably null
R5368:Plch1	UTSW	3	63701973	missense	possibly damaging	0.82
R5373:Plch1	UTSW	3	63698078	missense	probably benign	0.01
R5374:Plch1	UTSW	3	63698078	missense	probably benign	0.01
R5501:Plch1	UTSW	3	63707741	missense	probably damaging	1.00
R5606:Plch1	UTSW	3	63740687	missense	probably benign	0.35
R5738:Plch1	UTSW	3	63773655	missense	probably damaging	1.00
R5835:Plch1	UTSW	3	63697522	missense	probably benign
R6106:Plch1	UTSW	3	63702023	missense	probably damaging	1.00
R6107:Plch1	UTSW	3	63702023	missense	probably damaging	1.00
R6108:Plch1	UTSW	3	63702023	missense	probably damaging	1.00
R6110:Plch1	UTSW	3	63698858	missense	possibly damaging	0.62
R6116:Plch1	UTSW	3	63702023	missense	probably damaging	1.00
R6147:Plch1	UTSW	3	63722881	missense	probably damaging	1.00
R6195:Plch1	UTSW	3	63740789	missense	probably damaging	1.00
R6315:Plch1	UTSW	3	63781390	nonsense	probably null
R6316:Plch1	UTSW	3	63781390	nonsense	probably null
R6317:Plch1	UTSW	3	63781390	nonsense	probably null
R6318:Plch1	UTSW	3	63781390	nonsense	probably null
R6324:Plch1	UTSW	3	63781390	nonsense	probably null
R6325:Plch1	UTSW	3	63781390	nonsense	probably null
R6326:Plch1	UTSW	3	63781390	nonsense	probably null
R6479:Plch1	UTSW	3	63744510	missense	probably benign	0.06
R6544:Plch1	UTSW	3	63850978	missense	probably damaging	1.00
R6767:Plch1	UTSW	3	63755344	missense	probably damaging	1.00
R6829:Plch1	UTSW	3	63697518	missense	probably damaging	0.99
R6891:Plch1	UTSW	3	63698083	missense	probably benign
R6893:Plch1	UTSW	3	63753141	nonsense	probably null
R6921:Plch1	UTSW	3	63707734	missense	possibly damaging	0.90
R7298:Plch1	UTSW	3	63716037	nonsense	probably null
R7396:Plch1	UTSW	3	63698954	missense	probably benign	0.00
R7420:Plch1	UTSW	3	63722857	missense	probably damaging	1.00
R7566:Plch1	UTSW	3	63781242	splice site	probably null
R7572:Plch1	UTSW	3	63740684	missense	possibly damaging	0.89
R7649:Plch1	UTSW	3	63698169	nonsense	probably null
R7696:Plch1	UTSW	3	63755305	missense	probably benign
R7851:Plch1	UTSW	3	63698434	missense	probably damaging	0.99
R7853:Plch1	UTSW	3	63773647	missense	probably benign	0.44
R7932:Plch1	UTSW	3	63701981	missense	probably benign	0.05
R7983:Plch1	UTSW	3	63707743	missense	probably damaging	1.00
R8057:Plch1	UTSW	3	63698136	missense	probably benign
R8066:Plch1	UTSW	3	63711057	nonsense	probably null
R8206:Plch1	UTSW	3	63702626	splice site	probably null
RF018:Plch1	UTSW	3	63721215	missense	probably damaging	1.00
X0028:Plch1	UTSW	3	63744509	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- AAGGATATTGGTCATGGGTCC -3'
(R):5'- GCACATTGGGTCTTGAAAAGC -3'

Sequencing Primer
(F):5'- ATATTGGTCATGGGTCCTCTGCC -3'
(R):5'- TTGGGTCTTGAAAAGCACCAC -3'

Posted On

2015-09-24