Incidental Mutation 'R4589:Olfr648'
ID342679
Institutional Source Beutler Lab
Gene Symbol Olfr648
Ensembl Gene ENSMUSG00000042909
Gene Nameolfactory receptor 648
SynonymsGA_x6K02T2PBJ9-6914780-6913830, MOR31-12
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.471) question?
Stock #R4589 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104177598-104183392 bp(-) (GRCm38)
Type of Mutationsplice site (27 bp from exon)
DNA Base Change (assembly) C to A at 104179429 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000052659] [ENSMUST00000216612]
Predicted Effect probably null
Transcript: ENSMUST00000052659
SMART Domains Protein: ENSMUSP00000062529
Gene: ENSMUSG00000042909

DomainStartEndE-ValueType
Pfam:7tm_4 33 312 2e-111 PFAM
Pfam:7TM_GPCR_Srsx 37 309 7.7e-7 PFAM
Pfam:7tm_1 43 294 3.1e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000104877
SMART Domains Protein: ENSMUSP00000100471
Gene: ENSMUSG00000042909

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 37 309 1.1e-8 PFAM
Pfam:7tm_1 43 294 3.6e-28 PFAM
Pfam:7tm_4 141 287 1.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216612
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,773,582 S223P probably damaging Het
Abcc1 G T 16: 14,394,031 V157L probably benign Het
Actn1 G A 12: 80,171,799 T737I possibly damaging Het
Ada T C 2: 163,732,948 K90E possibly damaging Het
Ap2b1 T A 11: 83,333,011 L184* probably null Het
Arfgef3 T C 10: 18,646,199 D693G probably damaging Het
Arid4a A T 12: 71,069,964 I277F probably damaging Het
BC003331 C T 1: 150,384,487 V127I probably benign Het
Ccdc171 A G 4: 83,549,618 S67G probably benign Het
Ccr5 T A 9: 124,124,502 F47L probably benign Het
Clip4 T A 17: 71,810,867 C302* probably null Het
Cyth1 C T 11: 118,184,985 V142I possibly damaging Het
Ddx59 T A 1: 136,439,742 probably null Het
Def6 G T 17: 28,228,147 R584L probably benign Het
Dnah7c C A 1: 46,514,583 Y340* probably null Het
Eif2ak4 T G 2: 118,417,338 C173W probably damaging Het
Gm14403 C T 2: 177,508,635 H125Y probably benign Het
Grk3 T C 5: 112,941,718 I323V possibly damaging Het
Homez G T 14: 54,857,030 T407K probably damaging Het
Igdcc4 A G 9: 65,130,628 T763A probably damaging Het
Ighg2b A T 12: 113,306,484 W305R unknown Het
Il27ra G T 8: 84,036,409 N296K probably damaging Het
Lzic G T 4: 149,488,104 L50F probably damaging Het
Mbtd1 T C 11: 93,921,419 V183A probably damaging Het
Mme T A 3: 63,380,272 D731E probably benign Het
Mocos T C 18: 24,654,038 L38P probably damaging Het
Mrps18a T C 17: 46,117,973 probably null Het
Msh2 T A 17: 87,680,032 V200D possibly damaging Het
Mug1 A T 6: 121,857,351 I364F probably benign Het
Mycbp2 G T 14: 103,177,313 S2554R probably benign Het
Nat10 A G 2: 103,754,070 C121R probably damaging Het
Nfatc3 T A 8: 106,079,073 D183E probably damaging Het
Olfr1162 T C 2: 88,050,479 I48M probably benign Het
Olfr1426 T C 19: 12,087,941 I284V possibly damaging Het
Olfr616 A T 7: 103,564,432 F282L probably damaging Het
Pak6 T A 2: 118,696,540 I672K probably damaging Het
Pan3 A T 5: 147,543,173 I830F probably damaging Het
Pcdh9 A T 14: 93,888,192 L181I probably damaging Het
Pigg G A 5: 108,332,690 A447T probably benign Het
Pitpnb T A 5: 111,371,348 S165T probably damaging Het
Pla2g2a A G 4: 138,833,279 Y67C probably damaging Het
Plch1 A G 3: 63,781,507 I80T probably damaging Het
Pnma1 A G 12: 84,147,461 I156T probably benign Het
Prss21 G T 17: 23,872,822 D255Y possibly damaging Het
Prune1 T A 3: 95,262,331 I187F possibly damaging Het
Rab7b T C 1: 131,705,647 F78L probably benign Het
Riok3 T A 18: 12,136,787 Y92N probably benign Het
Rpap2 T C 5: 107,620,495 S400P probably benign Het
Ryr3 C A 2: 112,875,133 G792V probably damaging Het
Sept3 A G 15: 82,285,891 E206G probably damaging Het
Stkld1 T C 2: 26,950,667 S454P probably damaging Het
Tdh A T 14: 63,495,877 L140Q probably damaging Het
Tex15 T A 8: 33,557,373 H159Q probably damaging Het
Tmed6 C T 8: 107,064,161 V85I probably benign Het
Vmn1r174 T A 7: 23,754,779 L290* probably null Het
Vmn1r31 A G 6: 58,472,611 S90P probably damaging Het
Vmn2r55 T C 7: 12,670,895 T194A probably damaging Het
Vmn2r82 A T 10: 79,356,714 I42F probably damaging Het
Vps35 G A 8: 85,287,702 P106L probably damaging Het
Xrcc6 T A 15: 82,022,460 Y69N probably damaging Het
Zbtb14 C T 17: 69,388,470 P388S probably damaging Het
Zfp541 C T 7: 16,083,336 A902V probably benign Het
Other mutations in Olfr648
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02121:Olfr648 APN 7 104180225 missense probably damaging 1.00
IGL02488:Olfr648 APN 7 104180271 missense possibly damaging 0.66
IGL02956:Olfr648 APN 7 104180127 missense probably damaging 1.00
R0001:Olfr648 UTSW 7 104179473 nonsense probably null
R0057:Olfr648 UTSW 7 104180329 missense probably benign 0.13
R1054:Olfr648 UTSW 7 104180291 missense probably benign 0.02
R1262:Olfr648 UTSW 7 104179416 splice site probably null
R4975:Olfr648 UTSW 7 104179529 missense probably damaging 1.00
R5068:Olfr648 UTSW 7 104180241 missense probably damaging 1.00
R5643:Olfr648 UTSW 7 104179884 missense probably benign 0.00
R6195:Olfr648 UTSW 7 104179754 missense possibly damaging 0.78
R6211:Olfr648 UTSW 7 104179747 nonsense probably null
R6233:Olfr648 UTSW 7 104179754 missense possibly damaging 0.78
R6259:Olfr648 UTSW 7 104180054 missense possibly damaging 0.53
R7138:Olfr648 UTSW 7 104180297 missense probably damaging 1.00
R7357:Olfr648 UTSW 7 104179771 missense probably damaging 1.00
R7570:Olfr648 UTSW 7 104179748 missense probably damaging 1.00
R8352:Olfr648 UTSW 7 104179896 missense probably damaging 1.00
R8452:Olfr648 UTSW 7 104179896 missense probably damaging 1.00
X0018:Olfr648 UTSW 7 104179590 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTGTCAGTGCCATTACACAAC -3'
(R):5'- GCGGTTCCCATGTCTGTGTC -3'

Sequencing Primer
(F):5'- TGTCAGTGCCATTACACAACAAAGG -3'
(R):5'- GCTCATCGCTTTGGACACAATG -3'
Posted On2015-09-24