Incidental Mutation 'R4589:Ccr5'
ID342687
Institutional Source Beutler Lab
Gene Symbol Ccr5
Ensembl Gene ENSMUSG00000079227
Gene Namechemokine (C-C motif) receptor 5
SynonymsCmkbr5, CD195
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R4589 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location124121543-124147699 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 124124502 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 47 (F47L)
Ref Sequence ENSEMBL: ENSMUSP00000127328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111442] [ENSMUST00000168179] [ENSMUST00000171499]
Predicted Effect probably benign
Transcript: ENSMUST00000097855
Predicted Effect probably benign
Transcript: ENSMUST00000111442
AA Change: F47L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107069
Gene: ENSMUSG00000079227
AA Change: F47L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 43 314 3.8e-6 PFAM
Pfam:7tm_1 49 299 3.6e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169553
Predicted Effect probably benign
Transcript: ENSMUST00000171499
AA Change: F47L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000127328
Gene: ENSMUSG00000079227
AA Change: F47L

DomainStartEndE-ValueType
Pfam:7tm_1 49 123 1.1e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171579
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. This protein is expressed by T cells and macrophages, and is known to be an important co-receptor for macrophage-tropic virus, including HIV, to enter host cells. Defective alleles of this gene have been associated with the HIV infection resistance. The ligands of this receptor include monocyte chemoattractant protein 2 (MCP-2), macrophage inflammatory protein 1 alpha (MIP-1 alpha), macrophage inflammatory protein 1 beta (MIP-1 beta) and regulated on activation normal T expressed and secreted protein (RANTES). Expression of this gene was also detected in a promyeloblastic cell line, suggesting that this protein may play a role in granulocyte lineage proliferation and differentiation. This gene is located at the chemokine receptor gene cluster region. An allelic polymorphism in this gene results in both functional and non-functional alleles; the reference genome represents the functional allele. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice that are homozygous for null alleles have leukocytes with defective migration and adhesion, are more susceptibility to fungal & bacterial infections, have increased length of allograft survival, and have decreased susceptibility to endotoxin shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,773,582 S223P probably damaging Het
Abcc1 G T 16: 14,394,031 V157L probably benign Het
Actn1 G A 12: 80,171,799 T737I possibly damaging Het
Ada T C 2: 163,732,948 K90E possibly damaging Het
Ap2b1 T A 11: 83,333,011 L184* probably null Het
Arfgef3 T C 10: 18,646,199 D693G probably damaging Het
Arid4a A T 12: 71,069,964 I277F probably damaging Het
BC003331 C T 1: 150,384,487 V127I probably benign Het
Ccdc171 A G 4: 83,549,618 S67G probably benign Het
Clip4 T A 17: 71,810,867 C302* probably null Het
Cyth1 C T 11: 118,184,985 V142I possibly damaging Het
Ddx59 T A 1: 136,439,742 probably null Het
Def6 G T 17: 28,228,147 R584L probably benign Het
Dnah7c C A 1: 46,514,583 Y340* probably null Het
Eif2ak4 T G 2: 118,417,338 C173W probably damaging Het
Gm14403 C T 2: 177,508,635 H125Y probably benign Het
Grk3 T C 5: 112,941,718 I323V possibly damaging Het
Homez G T 14: 54,857,030 T407K probably damaging Het
Igdcc4 A G 9: 65,130,628 T763A probably damaging Het
Ighg2b A T 12: 113,306,484 W305R unknown Het
Il27ra G T 8: 84,036,409 N296K probably damaging Het
Lzic G T 4: 149,488,104 L50F probably damaging Het
Mbtd1 T C 11: 93,921,419 V183A probably damaging Het
Mme T A 3: 63,380,272 D731E probably benign Het
Mocos T C 18: 24,654,038 L38P probably damaging Het
Mrps18a T C 17: 46,117,973 probably null Het
Msh2 T A 17: 87,680,032 V200D possibly damaging Het
Mug1 A T 6: 121,857,351 I364F probably benign Het
Mycbp2 G T 14: 103,177,313 S2554R probably benign Het
Nat10 A G 2: 103,754,070 C121R probably damaging Het
Nfatc3 T A 8: 106,079,073 D183E probably damaging Het
Olfr1162 T C 2: 88,050,479 I48M probably benign Het
Olfr1426 T C 19: 12,087,941 I284V possibly damaging Het
Olfr616 A T 7: 103,564,432 F282L probably damaging Het
Olfr648 C A 7: 104,179,429 probably null Het
Pak6 T A 2: 118,696,540 I672K probably damaging Het
Pan3 A T 5: 147,543,173 I830F probably damaging Het
Pcdh9 A T 14: 93,888,192 L181I probably damaging Het
Pigg G A 5: 108,332,690 A447T probably benign Het
Pitpnb T A 5: 111,371,348 S165T probably damaging Het
Pla2g2a A G 4: 138,833,279 Y67C probably damaging Het
Plch1 A G 3: 63,781,507 I80T probably damaging Het
Pnma1 A G 12: 84,147,461 I156T probably benign Het
Prss21 G T 17: 23,872,822 D255Y possibly damaging Het
Prune1 T A 3: 95,262,331 I187F possibly damaging Het
Rab7b T C 1: 131,705,647 F78L probably benign Het
Riok3 T A 18: 12,136,787 Y92N probably benign Het
Rpap2 T C 5: 107,620,495 S400P probably benign Het
Ryr3 C A 2: 112,875,133 G792V probably damaging Het
Sept3 A G 15: 82,285,891 E206G probably damaging Het
Stkld1 T C 2: 26,950,667 S454P probably damaging Het
Tdh A T 14: 63,495,877 L140Q probably damaging Het
Tex15 T A 8: 33,557,373 H159Q probably damaging Het
Tmed6 C T 8: 107,064,161 V85I probably benign Het
Vmn1r174 T A 7: 23,754,779 L290* probably null Het
Vmn1r31 A G 6: 58,472,611 S90P probably damaging Het
Vmn2r55 T C 7: 12,670,895 T194A probably damaging Het
Vmn2r82 A T 10: 79,356,714 I42F probably damaging Het
Vps35 G A 8: 85,287,702 P106L probably damaging Het
Xrcc6 T A 15: 82,022,460 Y69N probably damaging Het
Zbtb14 C T 17: 69,388,470 P388S probably damaging Het
Zfp541 C T 7: 16,083,336 A902V probably benign Het
Other mutations in Ccr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Ccr5 APN 9 124124406 missense possibly damaging 0.59
IGL00551:Ccr5 APN 9 124124588 missense probably damaging 1.00
IGL01153:Ccr5 APN 9 124124612 missense probably damaging 1.00
R0014:Ccr5 UTSW 9 124124621 missense probably damaging 1.00
R0014:Ccr5 UTSW 9 124124621 missense probably damaging 1.00
R0355:Ccr5 UTSW 9 124124914 missense possibly damaging 0.90
R1570:Ccr5 UTSW 9 124124963 missense probably benign 0.29
R4305:Ccr5 UTSW 9 124125074 missense possibly damaging 0.78
R4307:Ccr5 UTSW 9 124125074 missense possibly damaging 0.78
R4570:Ccr5 UTSW 9 124124875 nonsense probably null
R5549:Ccr5 UTSW 9 124125371 missense probably benign 0.09
R5566:Ccr5 UTSW 9 124124660 missense probably benign 0.07
R5871:Ccr5 UTSW 9 124124521 missense probably benign 0.02
R6568:Ccr5 UTSW 9 124125199 missense probably damaging 0.99
R7258:Ccr5 UTSW 9 124125274 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGTAGGCCAACAATTGCTTTAACC -3'
(R):5'- TGTGATAGAGCCCTGTGAATAC -3'

Sequencing Primer
(F):5'- TGCTTTAACCTTTATTAAGCATTGTC -3'
(R):5'- AGAGCCCTGTGAATACTTTACAC -3'
Posted On2015-09-24