Incidental Mutation 'R4589:Arfgef3'
ID342688
Institutional Source Beutler Lab
Gene Symbol Arfgef3
Ensembl Gene ENSMUSG00000019852
Gene NameARFGEF family member 3
SynonymsB930094H20Rik, D10Bwg1379e, BIG3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R4589 (G1)
Quality Score217
Status Not validated
Chromosome10
Chromosomal Location18581839-18743949 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18646199 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 693 (D693G)
Ref Sequence ENSEMBL: ENSMUSP00000149210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019999] [ENSMUST00000215836]
Predicted Effect probably damaging
Transcript: ENSMUST00000019999
AA Change: D693G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019999
Gene: ENSMUSG00000019852
AA Change: D693G

DomainStartEndE-ValueType
Pfam:DCB 1 170 7.1e-15 PFAM
low complexity region 236 245 N/A INTRINSIC
low complexity region 276 295 N/A INTRINSIC
low complexity region 452 462 N/A INTRINSIC
Sec7 582 794 6e-54 SMART
Blast:Sec7 798 873 3e-20 BLAST
low complexity region 927 940 N/A INTRINSIC
Pfam:DUF1981 1237 1312 1.9e-14 PFAM
low complexity region 1641 1652 N/A INTRINSIC
low complexity region 1710 1723 N/A INTRINSIC
low complexity region 1838 1856 N/A INTRINSIC
low complexity region 2088 2099 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000215836
AA Change: D693G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased insulin granule biogenesis and insulin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,773,582 S223P probably damaging Het
Abcc1 G T 16: 14,394,031 V157L probably benign Het
Actn1 G A 12: 80,171,799 T737I possibly damaging Het
Ada T C 2: 163,732,948 K90E possibly damaging Het
Ap2b1 T A 11: 83,333,011 L184* probably null Het
Arid4a A T 12: 71,069,964 I277F probably damaging Het
BC003331 C T 1: 150,384,487 V127I probably benign Het
Ccdc171 A G 4: 83,549,618 S67G probably benign Het
Ccr5 T A 9: 124,124,502 F47L probably benign Het
Clip4 T A 17: 71,810,867 C302* probably null Het
Cyth1 C T 11: 118,184,985 V142I possibly damaging Het
Ddx59 T A 1: 136,439,742 probably null Het
Def6 G T 17: 28,228,147 R584L probably benign Het
Dnah7c C A 1: 46,514,583 Y340* probably null Het
Eif2ak4 T G 2: 118,417,338 C173W probably damaging Het
Gm14403 C T 2: 177,508,635 H125Y probably benign Het
Grk3 T C 5: 112,941,718 I323V possibly damaging Het
Homez G T 14: 54,857,030 T407K probably damaging Het
Igdcc4 A G 9: 65,130,628 T763A probably damaging Het
Ighg2b A T 12: 113,306,484 W305R unknown Het
Il27ra G T 8: 84,036,409 N296K probably damaging Het
Lzic G T 4: 149,488,104 L50F probably damaging Het
Mbtd1 T C 11: 93,921,419 V183A probably damaging Het
Mme T A 3: 63,380,272 D731E probably benign Het
Mocos T C 18: 24,654,038 L38P probably damaging Het
Mrps18a T C 17: 46,117,973 probably null Het
Msh2 T A 17: 87,680,032 V200D possibly damaging Het
Mug1 A T 6: 121,857,351 I364F probably benign Het
Mycbp2 G T 14: 103,177,313 S2554R probably benign Het
Nat10 A G 2: 103,754,070 C121R probably damaging Het
Nfatc3 T A 8: 106,079,073 D183E probably damaging Het
Olfr1162 T C 2: 88,050,479 I48M probably benign Het
Olfr1426 T C 19: 12,087,941 I284V possibly damaging Het
Olfr616 A T 7: 103,564,432 F282L probably damaging Het
Olfr648 C A 7: 104,179,429 probably null Het
Pak6 T A 2: 118,696,540 I672K probably damaging Het
Pan3 A T 5: 147,543,173 I830F probably damaging Het
Pcdh9 A T 14: 93,888,192 L181I probably damaging Het
Pigg G A 5: 108,332,690 A447T probably benign Het
Pitpnb T A 5: 111,371,348 S165T probably damaging Het
Pla2g2a A G 4: 138,833,279 Y67C probably damaging Het
Plch1 A G 3: 63,781,507 I80T probably damaging Het
Pnma1 A G 12: 84,147,461 I156T probably benign Het
Prss21 G T 17: 23,872,822 D255Y possibly damaging Het
Prune1 T A 3: 95,262,331 I187F possibly damaging Het
Rab7b T C 1: 131,705,647 F78L probably benign Het
Riok3 T A 18: 12,136,787 Y92N probably benign Het
Rpap2 T C 5: 107,620,495 S400P probably benign Het
Ryr3 C A 2: 112,875,133 G792V probably damaging Het
Sept3 A G 15: 82,285,891 E206G probably damaging Het
Stkld1 T C 2: 26,950,667 S454P probably damaging Het
Tdh A T 14: 63,495,877 L140Q probably damaging Het
Tex15 T A 8: 33,557,373 H159Q probably damaging Het
Tmed6 C T 8: 107,064,161 V85I probably benign Het
Vmn1r174 T A 7: 23,754,779 L290* probably null Het
Vmn1r31 A G 6: 58,472,611 S90P probably damaging Het
Vmn2r55 T C 7: 12,670,895 T194A probably damaging Het
Vmn2r82 A T 10: 79,356,714 I42F probably damaging Het
Vps35 G A 8: 85,287,702 P106L probably damaging Het
Xrcc6 T A 15: 82,022,460 Y69N probably damaging Het
Zbtb14 C T 17: 69,388,470 P388S probably damaging Het
Zfp541 C T 7: 16,083,336 A902V probably benign Het
Other mutations in Arfgef3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00769:Arfgef3 APN 10 18660604 missense probably benign 0.03
IGL00835:Arfgef3 APN 10 18661358 missense probably benign
IGL00961:Arfgef3 APN 10 18611237 missense probably damaging 1.00
IGL01400:Arfgef3 APN 10 18652706 missense probably damaging 1.00
IGL01501:Arfgef3 APN 10 18600560 missense possibly damaging 0.93
IGL01595:Arfgef3 APN 10 18594912 missense possibly damaging 0.93
IGL01695:Arfgef3 APN 10 18603419 missense probably benign 0.00
IGL01774:Arfgef3 APN 10 18743615 missense possibly damaging 0.94
IGL02348:Arfgef3 APN 10 18591347 missense probably benign 0.04
IGL02371:Arfgef3 APN 10 18646539 missense probably benign
IGL02400:Arfgef3 APN 10 18646257 missense probably damaging 1.00
IGL02630:Arfgef3 APN 10 18661392 splice site probably benign
IGL02815:Arfgef3 APN 10 18652551 missense probably damaging 1.00
IGL03178:Arfgef3 APN 10 18613225 missense probably damaging 1.00
IGL03182:Arfgef3 APN 10 18600544 missense probably damaging 1.00
IGL03267:Arfgef3 APN 10 18591882 missense probably damaging 1.00
IGL03294:Arfgef3 APN 10 18664912 missense probably damaging 0.97
IGL03410:Arfgef3 APN 10 18600490 missense probably damaging 1.00
Bow-wow UTSW 10 18646730 nonsense probably null
R0098:Arfgef3 UTSW 10 18589642 missense probably damaging 1.00
R0098:Arfgef3 UTSW 10 18589642 missense probably damaging 1.00
R0141:Arfgef3 UTSW 10 18597407 missense probably damaging 1.00
R0164:Arfgef3 UTSW 10 18647915 missense possibly damaging 0.77
R0164:Arfgef3 UTSW 10 18647915 missense possibly damaging 0.77
R0241:Arfgef3 UTSW 10 18599214 missense probably damaging 1.00
R0334:Arfgef3 UTSW 10 18592281 missense probably damaging 0.98
R0352:Arfgef3 UTSW 10 18661387 missense probably benign 0.17
R0415:Arfgef3 UTSW 10 18613127 splice site probably benign
R0417:Arfgef3 UTSW 10 18603511 missense probably damaging 1.00
R0442:Arfgef3 UTSW 10 18677815 splice site probably benign
R0507:Arfgef3 UTSW 10 18591621 missense probably damaging 1.00
R0573:Arfgef3 UTSW 10 18599288 missense probably damaging 1.00
R0582:Arfgef3 UTSW 10 18611290 missense probably damaging 1.00
R0609:Arfgef3 UTSW 10 18597431 missense probably benign 0.31
R0826:Arfgef3 UTSW 10 18589666 missense probably damaging 0.98
R0919:Arfgef3 UTSW 10 18589735 missense possibly damaging 0.89
R0980:Arfgef3 UTSW 10 18592118 missense possibly damaging 0.82
R1027:Arfgef3 UTSW 10 18591375 missense probably benign 0.02
R1140:Arfgef3 UTSW 10 18597348 missense possibly damaging 0.77
R1491:Arfgef3 UTSW 10 18646554 missense probably damaging 1.00
R1493:Arfgef3 UTSW 10 18630879 missense probably damaging 0.96
R1529:Arfgef3 UTSW 10 18613222 nonsense probably null
R1564:Arfgef3 UTSW 10 18591704 missense probably damaging 1.00
R1654:Arfgef3 UTSW 10 18625148 missense probably null 0.15
R1868:Arfgef3 UTSW 10 18661387 missense probably benign 0.17
R1876:Arfgef3 UTSW 10 18597356 missense probably damaging 1.00
R1908:Arfgef3 UTSW 10 18652763 missense possibly damaging 0.80
R2211:Arfgef3 UTSW 10 18592245 missense possibly damaging 0.54
R2316:Arfgef3 UTSW 10 18616953 missense probably benign 0.19
R2393:Arfgef3 UTSW 10 18597787 missense possibly damaging 0.88
R2407:Arfgef3 UTSW 10 18677866 missense possibly damaging 0.63
R3076:Arfgef3 UTSW 10 18603530 missense probably damaging 0.99
R3077:Arfgef3 UTSW 10 18603530 missense probably damaging 0.99
R3963:Arfgef3 UTSW 10 18592277 missense probably damaging 1.00
R4201:Arfgef3 UTSW 10 18619782 missense probably benign 0.01
R4241:Arfgef3 UTSW 10 18625164 missense probably damaging 1.00
R4244:Arfgef3 UTSW 10 18630420 missense probably damaging 1.00
R4395:Arfgef3 UTSW 10 18597709 missense probably damaging 1.00
R4455:Arfgef3 UTSW 10 18607675 missense probably benign 0.18
R4480:Arfgef3 UTSW 10 18600600 missense probably damaging 1.00
R4499:Arfgef3 UTSW 10 18608343 missense possibly damaging 0.95
R4635:Arfgef3 UTSW 10 18634855 missense probably damaging 1.00
R4776:Arfgef3 UTSW 10 18654247 missense probably benign
R4801:Arfgef3 UTSW 10 18591906 missense probably benign 0.00
R4802:Arfgef3 UTSW 10 18591906 missense probably benign 0.00
R4807:Arfgef3 UTSW 10 18646637 missense probably benign
R4828:Arfgef3 UTSW 10 18652693 missense probably damaging 0.99
R4861:Arfgef3 UTSW 10 18607731 missense probably benign 0.01
R4861:Arfgef3 UTSW 10 18607731 missense probably benign 0.01
R4917:Arfgef3 UTSW 10 18616890 missense probably damaging 0.99
R4918:Arfgef3 UTSW 10 18616890 missense probably damaging 0.99
R4922:Arfgef3 UTSW 10 18592186 missense probably damaging 0.97
R4929:Arfgef3 UTSW 10 18630851 missense probably benign 0.00
R4937:Arfgef3 UTSW 10 18589706 missense probably damaging 0.98
R5290:Arfgef3 UTSW 10 18600460 missense probably damaging 1.00
R5410:Arfgef3 UTSW 10 18611237 missense probably damaging 0.99
R5807:Arfgef3 UTSW 10 18647798 splice site probably null
R5832:Arfgef3 UTSW 10 18630420 missense probably damaging 1.00
R5887:Arfgef3 UTSW 10 18607665 nonsense probably null
R6272:Arfgef3 UTSW 10 18646963 missense probably benign 0.00
R6302:Arfgef3 UTSW 10 18652841 missense probably damaging 0.97
R6397:Arfgef3 UTSW 10 18607665 nonsense probably null
R6495:Arfgef3 UTSW 10 18611202 critical splice donor site probably null
R6707:Arfgef3 UTSW 10 18621155 missense probably benign 0.11
R6814:Arfgef3 UTSW 10 18595019 missense probably damaging 1.00
R6830:Arfgef3 UTSW 10 18664889 critical splice donor site probably null
R6870:Arfgef3 UTSW 10 18646730 nonsense probably null
R6941:Arfgef3 UTSW 10 18625455 missense possibly damaging 0.66
R7094:Arfgef3 UTSW 10 18646439 missense probably damaging 1.00
R7179:Arfgef3 UTSW 10 18599267 missense probably damaging 1.00
R7204:Arfgef3 UTSW 10 18646462 missense probably damaging 1.00
R7247:Arfgef3 UTSW 10 18625391 missense probably benign 0.00
R7249:Arfgef3 UTSW 10 18630835 missense possibly damaging 0.62
R7318:Arfgef3 UTSW 10 18630463 missense possibly damaging 0.89
R7391:Arfgef3 UTSW 10 18646259 missense probably benign 0.05
R7527:Arfgef3 UTSW 10 18646629 missense probably benign
R7618:Arfgef3 UTSW 10 18646281 missense probably damaging 1.00
R7779:Arfgef3 UTSW 10 18595023 missense probably damaging 0.99
R7851:Arfgef3 UTSW 10 18592286 missense probably damaging 1.00
R7934:Arfgef3 UTSW 10 18592286 missense probably damaging 1.00
X0026:Arfgef3 UTSW 10 18652626 missense probably damaging 1.00
Z1176:Arfgef3 UTSW 10 18591437 missense probably damaging 1.00
Z1176:Arfgef3 UTSW 10 18608358 missense probably damaging 0.97
Z1176:Arfgef3 UTSW 10 18634852 missense probably benign 0.26
Z1177:Arfgef3 UTSW 10 18607776 missense probably damaging 1.00
Z1177:Arfgef3 UTSW 10 18627628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGGAGGGACTGTATTAGGAACATG -3'
(R):5'- TGTGATCAGTATTCCATGGCG -3'

Sequencing Primer
(F):5'- ACTGTATTAGGAACATGAGCAAATG -3'
(R):5'- TTCCCTGGCTGATGAAGAAC -3'
Posted On2015-09-24