Incidental Mutation 'R4589:Cyth1'
ID342692
Institutional Source Beutler Lab
Gene Symbol Cyth1
Ensembl Gene ENSMUSG00000017132
Gene Namecytohesin 1
SynonymsCTH-1, Pscd1, CLM1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.137) question?
Stock #R4589 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location118132019-118248592 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 118184985 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 142 (V142I)
Ref Sequence ENSEMBL: ENSMUSP00000101912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017276] [ENSMUST00000100181] [ENSMUST00000106302] [ENSMUST00000106305] [ENSMUST00000151165]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017276
AA Change: V142I

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000017276
Gene: ENSMUSG00000017132
AA Change: V142I

DomainStartEndE-ValueType
Sec7 59 244 1.38e-108 SMART
PH 261 378 4.8e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000100181
AA Change: V156I

PolyPhen 2 Score 0.654 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097756
Gene: ENSMUSG00000017132
AA Change: V156I

DomainStartEndE-ValueType
Sec7 73 258 1.38e-108 SMART
PH 275 392 1.65e-23 SMART
low complexity region 402 425 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106302
AA Change: V144I

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101909
Gene: ENSMUSG00000017132
AA Change: V144I

DomainStartEndE-ValueType
Sec7 61 246 1.38e-108 SMART
PH 263 381 4.18e-25 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106305
AA Change: V142I

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000101912
Gene: ENSMUSG00000017132
AA Change: V142I

DomainStartEndE-ValueType
Sec7 59 244 1.38e-108 SMART
PH 261 379 4.18e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141243
Predicted Effect probably benign
Transcript: ENSMUST00000151165
SMART Domains Protein: ENSMUSP00000114792
Gene: ENSMUSG00000017132

DomainStartEndE-ValueType
SCOP:d1pbv__ 55 99 4e-15 SMART
PDB:1BC9|A 60 99 9e-21 PDB
Blast:Sec7 61 99 1e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157494
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the PSCD family. Members of this family have identical structural organization that consists of an N-terminal coiled-coil motif, a central Sec7 domain, and a C-terminal pleckstrin homology (PH) domain. The coiled-coil motif is involved in homodimerization, the Sec7 domain contains guanine-nucleotide exchange protein activity, and the PH domain interacts with phospholipids and is responsible for association of PSCDs with membranes. Members of this family appear to mediate the regulation of protein sorting and membrane trafficking. This gene is highly expressed in natural killer and peripheral T cells, and regulates the adhesiveness of integrins at the plasma membrane of lymphocytes. A pseudogene of this gene has been defined on the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit normal brain morphology and long term potentiation. Mice homozygous for a knock-out allele exhibit decreased myelin sheath thickness due to hypomyelination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,773,582 S223P probably damaging Het
Abcc1 G T 16: 14,394,031 V157L probably benign Het
Actn1 G A 12: 80,171,799 T737I possibly damaging Het
Ada T C 2: 163,732,948 K90E possibly damaging Het
Ap2b1 T A 11: 83,333,011 L184* probably null Het
Arfgef3 T C 10: 18,646,199 D693G probably damaging Het
Arid4a A T 12: 71,069,964 I277F probably damaging Het
BC003331 C T 1: 150,384,487 V127I probably benign Het
Ccdc171 A G 4: 83,549,618 S67G probably benign Het
Ccr5 T A 9: 124,124,502 F47L probably benign Het
Clip4 T A 17: 71,810,867 C302* probably null Het
Ddx59 T A 1: 136,439,742 probably null Het
Def6 G T 17: 28,228,147 R584L probably benign Het
Dnah7c C A 1: 46,514,583 Y340* probably null Het
Eif2ak4 T G 2: 118,417,338 C173W probably damaging Het
Gm14403 C T 2: 177,508,635 H125Y probably benign Het
Grk3 T C 5: 112,941,718 I323V possibly damaging Het
Homez G T 14: 54,857,030 T407K probably damaging Het
Igdcc4 A G 9: 65,130,628 T763A probably damaging Het
Ighg2b A T 12: 113,306,484 W305R unknown Het
Il27ra G T 8: 84,036,409 N296K probably damaging Het
Lzic G T 4: 149,488,104 L50F probably damaging Het
Mbtd1 T C 11: 93,921,419 V183A probably damaging Het
Mme T A 3: 63,380,272 D731E probably benign Het
Mocos T C 18: 24,654,038 L38P probably damaging Het
Mrps18a T C 17: 46,117,973 probably null Het
Msh2 T A 17: 87,680,032 V200D possibly damaging Het
Mug1 A T 6: 121,857,351 I364F probably benign Het
Mycbp2 G T 14: 103,177,313 S2554R probably benign Het
Nat10 A G 2: 103,754,070 C121R probably damaging Het
Nfatc3 T A 8: 106,079,073 D183E probably damaging Het
Olfr1162 T C 2: 88,050,479 I48M probably benign Het
Olfr1426 T C 19: 12,087,941 I284V possibly damaging Het
Olfr616 A T 7: 103,564,432 F282L probably damaging Het
Olfr648 C A 7: 104,179,429 probably null Het
Pak6 T A 2: 118,696,540 I672K probably damaging Het
Pan3 A T 5: 147,543,173 I830F probably damaging Het
Pcdh9 A T 14: 93,888,192 L181I probably damaging Het
Pigg G A 5: 108,332,690 A447T probably benign Het
Pitpnb T A 5: 111,371,348 S165T probably damaging Het
Pla2g2a A G 4: 138,833,279 Y67C probably damaging Het
Plch1 A G 3: 63,781,507 I80T probably damaging Het
Pnma1 A G 12: 84,147,461 I156T probably benign Het
Prss21 G T 17: 23,872,822 D255Y possibly damaging Het
Prune1 T A 3: 95,262,331 I187F possibly damaging Het
Rab7b T C 1: 131,705,647 F78L probably benign Het
Riok3 T A 18: 12,136,787 Y92N probably benign Het
Rpap2 T C 5: 107,620,495 S400P probably benign Het
Ryr3 C A 2: 112,875,133 G792V probably damaging Het
Sept3 A G 15: 82,285,891 E206G probably damaging Het
Stkld1 T C 2: 26,950,667 S454P probably damaging Het
Tdh A T 14: 63,495,877 L140Q probably damaging Het
Tex15 T A 8: 33,557,373 H159Q probably damaging Het
Tmed6 C T 8: 107,064,161 V85I probably benign Het
Vmn1r174 T A 7: 23,754,779 L290* probably null Het
Vmn1r31 A G 6: 58,472,611 S90P probably damaging Het
Vmn2r55 T C 7: 12,670,895 T194A probably damaging Het
Vmn2r82 A T 10: 79,356,714 I42F probably damaging Het
Vps35 G A 8: 85,287,702 P106L probably damaging Het
Xrcc6 T A 15: 82,022,460 Y69N probably damaging Het
Zbtb14 C T 17: 69,388,470 P388S probably damaging Het
Zfp541 C T 7: 16,083,336 A902V probably benign Het
Other mutations in Cyth1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Cyth1 APN 11 118193613 critical splice donor site probably null
IGL02047:Cyth1 APN 11 118169132 missense probably damaging 1.00
IGL02658:Cyth1 APN 11 118182246 missense probably damaging 0.99
IGL02826:Cyth1 APN 11 118185481 missense possibly damaging 0.89
Mucilage UTSW 11 118170860 missense probably damaging 1.00
Stuck UTSW 11 118185759 critical splice donor site probably null
tarred UTSW 11 118183923 nonsense probably null
R0109:Cyth1 UTSW 11 118182306 missense probably damaging 0.98
R0109:Cyth1 UTSW 11 118182306 missense probably damaging 0.98
R0470:Cyth1 UTSW 11 118132248 unclassified probably benign
R1387:Cyth1 UTSW 11 118182346 unclassified probably benign
R1599:Cyth1 UTSW 11 118177221 missense probably damaging 0.99
R2098:Cyth1 UTSW 11 118193653 missense probably damaging 1.00
R2156:Cyth1 UTSW 11 118182808 missense probably damaging 1.00
R3546:Cyth1 UTSW 11 118192436 missense probably damaging 0.96
R4300:Cyth1 UTSW 11 118183894 missense probably damaging 0.98
R4799:Cyth1 UTSW 11 118183942 missense probably damaging 1.00
R5165:Cyth1 UTSW 11 118169082 missense possibly damaging 0.82
R5524:Cyth1 UTSW 11 118182767 missense probably benign 0.27
R5834:Cyth1 UTSW 11 118192463 critical splice acceptor site probably null
R5933:Cyth1 UTSW 11 118185759 critical splice donor site probably null
R5960:Cyth1 UTSW 11 118132367 unclassified probably benign
R6609:Cyth1 UTSW 11 118170860 missense probably damaging 1.00
R7014:Cyth1 UTSW 11 118212651 missense probably benign
R7108:Cyth1 UTSW 11 118182913 missense probably damaging 0.99
R7237:Cyth1 UTSW 11 118185495 missense probably damaging 1.00
R7401:Cyth1 UTSW 11 118182251 missense possibly damaging 0.94
R7424:Cyth1 UTSW 11 118184009 splice site probably null
R7523:Cyth1 UTSW 11 118183923 nonsense probably null
R7574:Cyth1 UTSW 11 118182863 missense probably damaging 1.00
R7647:Cyth1 UTSW 11 118177288 missense probably benign 0.00
R7731:Cyth1 UTSW 11 118169053 missense possibly damaging 0.55
R7848:Cyth1 UTSW 11 118183923 nonsense probably null
R7849:Cyth1 UTSW 11 118183923 nonsense probably null
R7931:Cyth1 UTSW 11 118183923 nonsense probably null
R7932:Cyth1 UTSW 11 118183923 nonsense probably null
X0063:Cyth1 UTSW 11 118132329 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CGAAATACACAGCTACCTAGTTTAG -3'
(R):5'- TTAGTTAGCAAACAGAGCCAGGC -3'

Sequencing Primer
(F):5'- ATGAAAGGGTTTTCTATTGTGAAGAG -3'
(R):5'- AACAGCCTCGTGACTGTG -3'
Posted On2015-09-24