Incidental Mutation 'R4589:Def6'
ID342707
Institutional Source Beutler Lab
Gene Symbol Def6
Ensembl Gene ENSMUSG00000002257
Gene Namedifferentially expressed in FDCP 6
SynonymsIBP, SLAT, 6430538D02Rik, IRF-4-binding protein, 2410003F05Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4589 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location28207778-28228608 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 28228147 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 584 (R584L)
Ref Sequence ENSEMBL: ENSMUSP00000002327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002320] [ENSMUST00000002327]
Predicted Effect probably benign
Transcript: ENSMUST00000002320
SMART Domains Protein: ENSMUSP00000002320
Gene: ENSMUSG00000002250

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
ZnF_C4 70 140 1.58e-33 SMART
Blast:HOLI 183 208 1e-6 BLAST
HOLI 250 409 1.36e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000002327
AA Change: R584L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002327
Gene: ENSMUSG00000002257
AA Change: R584L

DomainStartEndE-ValueType
low complexity region 145 166 N/A INTRINSIC
PH 217 314 3.87e-20 SMART
coiled coil region 318 551 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166744
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEF6, or IBP, is a guanine nucleotide exchange factor (GEF) for RAC (MIM 602048) and CDC42 (MIM 116952) that is highly expressed in B and T cells (Gupta et al., 2003 [PubMed 12923183]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutants spontaneously develop systemic autoimmunity. Females primarily are affected, displaying hypergammaglobulinemia, accumulation of effector/memory T cells and IgG+ B cells, and production of autoantibodies [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,773,582 S223P probably damaging Het
Abcc1 G T 16: 14,394,031 V157L probably benign Het
Actn1 G A 12: 80,171,799 T737I possibly damaging Het
Ada T C 2: 163,732,948 K90E possibly damaging Het
Ap2b1 T A 11: 83,333,011 L184* probably null Het
Arfgef3 T C 10: 18,646,199 D693G probably damaging Het
Arid4a A T 12: 71,069,964 I277F probably damaging Het
BC003331 C T 1: 150,384,487 V127I probably benign Het
Ccdc171 A G 4: 83,549,618 S67G probably benign Het
Ccr5 T A 9: 124,124,502 F47L probably benign Het
Clip4 T A 17: 71,810,867 C302* probably null Het
Cyth1 C T 11: 118,184,985 V142I possibly damaging Het
Ddx59 T A 1: 136,439,742 probably null Het
Dnah7c C A 1: 46,514,583 Y340* probably null Het
Eif2ak4 T G 2: 118,417,338 C173W probably damaging Het
Gm14403 C T 2: 177,508,635 H125Y probably benign Het
Grk3 T C 5: 112,941,718 I323V possibly damaging Het
Homez G T 14: 54,857,030 T407K probably damaging Het
Igdcc4 A G 9: 65,130,628 T763A probably damaging Het
Ighg2b A T 12: 113,306,484 W305R unknown Het
Il27ra G T 8: 84,036,409 N296K probably damaging Het
Lzic G T 4: 149,488,104 L50F probably damaging Het
Mbtd1 T C 11: 93,921,419 V183A probably damaging Het
Mme T A 3: 63,380,272 D731E probably benign Het
Mocos T C 18: 24,654,038 L38P probably damaging Het
Mrps18a T C 17: 46,117,973 probably null Het
Msh2 T A 17: 87,680,032 V200D possibly damaging Het
Mug1 A T 6: 121,857,351 I364F probably benign Het
Mycbp2 G T 14: 103,177,313 S2554R probably benign Het
Nat10 A G 2: 103,754,070 C121R probably damaging Het
Nfatc3 T A 8: 106,079,073 D183E probably damaging Het
Olfr1162 T C 2: 88,050,479 I48M probably benign Het
Olfr1426 T C 19: 12,087,941 I284V possibly damaging Het
Olfr616 A T 7: 103,564,432 F282L probably damaging Het
Olfr648 C A 7: 104,179,429 probably null Het
Pak6 T A 2: 118,696,540 I672K probably damaging Het
Pan3 A T 5: 147,543,173 I830F probably damaging Het
Pcdh9 A T 14: 93,888,192 L181I probably damaging Het
Pigg G A 5: 108,332,690 A447T probably benign Het
Pitpnb T A 5: 111,371,348 S165T probably damaging Het
Pla2g2a A G 4: 138,833,279 Y67C probably damaging Het
Plch1 A G 3: 63,781,507 I80T probably damaging Het
Pnma1 A G 12: 84,147,461 I156T probably benign Het
Prss21 G T 17: 23,872,822 D255Y possibly damaging Het
Prune1 T A 3: 95,262,331 I187F possibly damaging Het
Rab7b T C 1: 131,705,647 F78L probably benign Het
Riok3 T A 18: 12,136,787 Y92N probably benign Het
Rpap2 T C 5: 107,620,495 S400P probably benign Het
Ryr3 C A 2: 112,875,133 G792V probably damaging Het
Sept3 A G 15: 82,285,891 E206G probably damaging Het
Stkld1 T C 2: 26,950,667 S454P probably damaging Het
Tdh A T 14: 63,495,877 L140Q probably damaging Het
Tex15 T A 8: 33,557,373 H159Q probably damaging Het
Tmed6 C T 8: 107,064,161 V85I probably benign Het
Vmn1r174 T A 7: 23,754,779 L290* probably null Het
Vmn1r31 A G 6: 58,472,611 S90P probably damaging Het
Vmn2r55 T C 7: 12,670,895 T194A probably damaging Het
Vmn2r82 A T 10: 79,356,714 I42F probably damaging Het
Vps35 G A 8: 85,287,702 P106L probably damaging Het
Xrcc6 T A 15: 82,022,460 Y69N probably damaging Het
Zbtb14 C T 17: 69,388,470 P388S probably damaging Het
Zfp541 C T 7: 16,083,336 A902V probably benign Het
Other mutations in Def6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Def6 APN 17 28219740 splice site probably benign
IGL01619:Def6 APN 17 28207864 missense probably damaging 1.00
IGL01737:Def6 APN 17 28223727 missense possibly damaging 0.94
IGL02550:Def6 APN 17 28228261 missense probably benign 0.03
R0013:Def6 UTSW 17 28217092 missense probably damaging 1.00
R0335:Def6 UTSW 17 28228069 missense possibly damaging 0.83
R0357:Def6 UTSW 17 28223935 missense probably damaging 1.00
R0373:Def6 UTSW 17 28220180 missense probably damaging 0.96
R1161:Def6 UTSW 17 28217619 missense probably benign 0.00
R1310:Def6 UTSW 17 28217619 missense probably benign 0.00
R1470:Def6 UTSW 17 28225982 missense possibly damaging 0.67
R1470:Def6 UTSW 17 28225982 missense possibly damaging 0.67
R1636:Def6 UTSW 17 28223918 missense possibly damaging 0.95
R1778:Def6 UTSW 17 28220186 missense probably benign 0.02
R2432:Def6 UTSW 17 28228069 missense probably benign 0.03
R3881:Def6 UTSW 17 28220215 missense probably damaging 1.00
R4402:Def6 UTSW 17 28219976 missense probably damaging 0.99
R4683:Def6 UTSW 17 28217635 missense probably damaging 0.99
R5704:Def6 UTSW 17 28228226 missense probably benign
R6481:Def6 UTSW 17 28226163 missense probably benign 0.00
R6805:Def6 UTSW 17 28223717 missense probably damaging 1.00
R7029:Def6 UTSW 17 28225969 missense probably benign 0.05
R7863:Def6 UTSW 17 28227867 missense possibly damaging 0.62
R8229:Def6 UTSW 17 28217755 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACTGAAGGTCAAAGGTTTCCC -3'
(R):5'- TGGTAGCACCAGGAATCACC -3'

Sequencing Primer
(F):5'- TCCCTTCTCCCAGAGCAGAG -3'
(R):5'- AGTCCGTAGACACAGCATCGG -3'
Posted On2015-09-24