Mutagenetix > Incidental Mutations

Incidental Mutation 'R4589:Zbtb14'

342709

Institutional Source

Beutler Lab

Gene Symbol

Zbtb14

Ensembl Gene

ENSMUSG00000049672

Gene Name

zinc finger and BTB domain containing 14

Synonyms

Zfp161, b2b1982Clo, ZF5

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.913) question?

Stock #

R4589 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

69383050-69390750 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 69388470 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 388 (P388S)

Ref Sequence

ENSEMBL: ENSMUSP00000108296 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062369] [ENSMUST00000112674] [ENSMUST00000112676]

Predicted Effect

probably damaging
Transcript: ENSMUST00000062369
AA Change: P388S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000054897
Gene: ENSMUSG00000049672
AA Change: P388S

Domain	Start	End	E-Value	Type
BTB	36	132	8.8e-26	SMART
low complexity region	154	171	N/A	INTRINSIC
ZnF_C2H2	277	299	7.26e-3	SMART
ZnF_C2H2	305	327	3.95e-4	SMART
ZnF_C2H2	333	355	9.88e-5	SMART
ZnF_C2H2	361	383	2.2e-2	SMART
ZnF_C2H2	389	412	2.02e-1	SMART
low complexity region	428	444	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112674
AA Change: P388S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000108294
Gene: ENSMUSG00000049672
AA Change: P388S

Domain	Start	End	E-Value	Type
BTB	36	132	8.8e-26	SMART
low complexity region	154	171	N/A	INTRINSIC
ZnF_C2H2	277	299	7.26e-3	SMART
ZnF_C2H2	305	327	3.95e-4	SMART
ZnF_C2H2	333	355	9.88e-5	SMART
ZnF_C2H2	361	383	2.2e-2	SMART
ZnF_C2H2	389	412	2.02e-1	SMART
low complexity region	428	444	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112676
AA Change: P388S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000108296
Gene: ENSMUSG00000049672
AA Change: P388S

Domain	Start	End	E-Value	Type
BTB	36	132	8.8e-26	SMART
low complexity region	154	171	N/A	INTRINSIC
ZnF_C2H2	277	299	7.26e-3	SMART
ZnF_C2H2	305	327	3.95e-4	SMART
ZnF_C2H2	333	355	9.88e-5	SMART
ZnF_C2H2	361	383	2.2e-2	SMART
ZnF_C2H2	389	412	2.02e-1	SMART
low complexity region	428	444	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for an ENU-induced mutation show exencephaly, cardiac defects including valve abnormalities, double outlet right ventricle, perimembranous ventricular septal defect, and atrioventricular septal defect, and renal anomalies such as duplex kidney, hydronephrosis, and kidney cysts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	A	G	14: 49,773,582	S223P	probably damaging	Het
Abcc1	G	T	16: 14,394,031	V157L	probably benign	Het
Actn1	G	A	12: 80,171,799	T737I	possibly damaging	Het
Ada	T	C	2: 163,732,948	K90E	possibly damaging	Het
Ap2b1	T	A	11: 83,333,011	L184*	probably null	Het
Arfgef3	T	C	10: 18,646,199	D693G	probably damaging	Het
Arid4a	A	T	12: 71,069,964	I277F	probably damaging	Het
BC003331	C	T	1: 150,384,487	V127I	probably benign	Het
Ccdc171	A	G	4: 83,549,618	S67G	probably benign	Het
Ccr5	T	A	9: 124,124,502	F47L	probably benign	Het
Clip4	T	A	17: 71,810,867	C302*	probably null	Het
Cyth1	C	T	11: 118,184,985	V142I	possibly damaging	Het
Ddx59	T	A	1: 136,439,742		probably null	Het
Def6	G	T	17: 28,228,147	R584L	probably benign	Het
Dnah7c	C	A	1: 46,514,583	Y340*	probably null	Het
Eif2ak4	T	G	2: 118,417,338	C173W	probably damaging	Het
Gm14403	C	T	2: 177,508,635	H125Y	probably benign	Het
Grk3	T	C	5: 112,941,718	I323V	possibly damaging	Het
Homez	G	T	14: 54,857,030	T407K	probably damaging	Het
Igdcc4	A	G	9: 65,130,628	T763A	probably damaging	Het
Ighg2b	A	T	12: 113,306,484	W305R	unknown	Het
Il27ra	G	T	8: 84,036,409	N296K	probably damaging	Het
Lzic	G	T	4: 149,488,104	L50F	probably damaging	Het
Mbtd1	T	C	11: 93,921,419	V183A	probably damaging	Het
Mme	T	A	3: 63,380,272	D731E	probably benign	Het
Mocos	T	C	18: 24,654,038	L38P	probably damaging	Het
Mrps18a	T	C	17: 46,117,973		probably null	Het
Msh2	T	A	17: 87,680,032	V200D	possibly damaging	Het
Mug1	A	T	6: 121,857,351	I364F	probably benign	Het
Mycbp2	G	T	14: 103,177,313	S2554R	probably benign	Het
Nat10	A	G	2: 103,754,070	C121R	probably damaging	Het
Nfatc3	T	A	8: 106,079,073	D183E	probably damaging	Het
Olfr1162	T	C	2: 88,050,479	I48M	probably benign	Het
Olfr1426	T	C	19: 12,087,941	I284V	possibly damaging	Het
Olfr616	A	T	7: 103,564,432	F282L	probably damaging	Het
Olfr648	C	A	7: 104,179,429		probably null	Het
Pak6	T	A	2: 118,696,540	I672K	probably damaging	Het
Pan3	A	T	5: 147,543,173	I830F	probably damaging	Het
Pcdh9	A	T	14: 93,888,192	L181I	probably damaging	Het
Pigg	G	A	5: 108,332,690	A447T	probably benign	Het
Pitpnb	T	A	5: 111,371,348	S165T	probably damaging	Het
Pla2g2a	A	G	4: 138,833,279	Y67C	probably damaging	Het
Plch1	A	G	3: 63,781,507	I80T	probably damaging	Het
Pnma1	A	G	12: 84,147,461	I156T	probably benign	Het
Prss21	G	T	17: 23,872,822	D255Y	possibly damaging	Het
Prune1	T	A	3: 95,262,331	I187F	possibly damaging	Het
Rab7b	T	C	1: 131,705,647	F78L	probably benign	Het
Riok3	T	A	18: 12,136,787	Y92N	probably benign	Het
Rpap2	T	C	5: 107,620,495	S400P	probably benign	Het
Ryr3	C	A	2: 112,875,133	G792V	probably damaging	Het
Sept3	A	G	15: 82,285,891	E206G	probably damaging	Het
Stkld1	T	C	2: 26,950,667	S454P	probably damaging	Het
Tdh	A	T	14: 63,495,877	L140Q	probably damaging	Het
Tex15	T	A	8: 33,557,373	H159Q	probably damaging	Het
Tmed6	C	T	8: 107,064,161	V85I	probably benign	Het
Vmn1r174	T	A	7: 23,754,779	L290*	probably null	Het
Vmn1r31	A	G	6: 58,472,611	S90P	probably damaging	Het
Vmn2r55	T	C	7: 12,670,895	T194A	probably damaging	Het
Vmn2r82	A	T	10: 79,356,714	I42F	probably damaging	Het
Vps35	G	A	8: 85,287,702	P106L	probably damaging	Het
Xrcc6	T	A	15: 82,022,460	Y69N	probably damaging	Het
Zfp541	C	T	7: 16,083,336	A902V	probably benign	Het

Other mutations in Zbtb14

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01622:Zbtb14	APN	17	69388189	missense	probably benign	0.04
IGL01623:Zbtb14	APN	17	69388189	missense	probably benign	0.04
IGL02477:Zbtb14	APN	17	69387695	missense	probably benign	0.00
PIT4687001:Zbtb14	UTSW	17	69388307	nonsense	probably null
R0736:Zbtb14	UTSW	17	69387802	missense	possibly damaging	0.66
R0811:Zbtb14	UTSW	17	69388502	missense	probably damaging	1.00
R0812:Zbtb14	UTSW	17	69388502	missense	probably damaging	1.00
R0829:Zbtb14	UTSW	17	69388502	missense	probably damaging	1.00
R0866:Zbtb14	UTSW	17	69388502	missense	probably damaging	1.00
R0946:Zbtb14	UTSW	17	69388502	missense	probably damaging	1.00
R0947:Zbtb14	UTSW	17	69388502	missense	probably damaging	1.00
R1052:Zbtb14	UTSW	17	69388502	missense	probably damaging	1.00
R1053:Zbtb14	UTSW	17	69388502	missense	probably damaging	1.00
R1056:Zbtb14	UTSW	17	69388502	missense	probably damaging	1.00
R1076:Zbtb14	UTSW	17	69388502	missense	probably damaging	1.00
R1187:Zbtb14	UTSW	17	69388502	missense	probably damaging	1.00
R1374:Zbtb14	UTSW	17	69387580	missense	probably damaging	1.00
R1471:Zbtb14	UTSW	17	69388502	missense	probably damaging	1.00
R1505:Zbtb14	UTSW	17	69387764	missense	probably benign	0.00
R1507:Zbtb14	UTSW	17	69387764	missense	probably benign	0.00
R1508:Zbtb14	UTSW	17	69387764	missense	probably benign	0.00
R1509:Zbtb14	UTSW	17	69387764	missense	probably benign	0.00
R1514:Zbtb14	UTSW	17	69388502	missense	probably damaging	1.00
R1680:Zbtb14	UTSW	17	69388502	missense	probably damaging	1.00
R1691:Zbtb14	UTSW	17	69388502	missense	probably damaging	1.00
R1712:Zbtb14	UTSW	17	69387580	missense	probably damaging	1.00
R1907:Zbtb14	UTSW	17	69387390	missense	possibly damaging	0.91
R1981:Zbtb14	UTSW	17	69388502	missense	probably damaging	1.00
R2916:Zbtb14	UTSW	17	69388219	missense	probably damaging	1.00
R2918:Zbtb14	UTSW	17	69388219	missense	probably damaging	1.00
R4622:Zbtb14	UTSW	17	69388347	missense	possibly damaging	0.80
R4812:Zbtb14	UTSW	17	69387582	missense	probably damaging	1.00
R6246:Zbtb14	UTSW	17	69387483	missense	possibly damaging	0.46
R6889:Zbtb14	UTSW	17	69387679	missense	probably damaging	1.00
R7575:Zbtb14	UTSW	17	69387447	missense	probably damaging	0.98
R7716:Zbtb14	UTSW	17	69387420	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AAAGGTTTCACCACCCAGGC -3'
(R):5'- AATTGTCTCCAGCTGCTGC -3'

Sequencing Primer
(F):5'- GAACACCTAAAAATCCATACAGGG -3'
(R):5'- CTGCTCAGCCTCAGCGG -3'

Posted On

2015-09-24