Incidental Mutation 'R4589:Msh2'
ID342711
Institutional Source Beutler Lab
Gene Symbol Msh2
Ensembl Gene ENSMUSG00000024151
Gene NamemutS homolog 2
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.843) question?
Stock #R4589 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location87672330-87723713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87680032 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 200 (V200D)
Ref Sequence ENSEMBL: ENSMUSP00000024967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024967]
Predicted Effect possibly damaging
Transcript: ENSMUST00000024967
AA Change: V200D

PolyPhen 2 Score 0.666 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000024967
Gene: ENSMUSG00000024151
AA Change: V200D

DomainStartEndE-ValueType
Pfam:MutS_I 17 132 4.6e-22 PFAM
Pfam:MutS_II 150 290 6.7e-23 PFAM
MUTSd 321 645 1e-105 SMART
MUTSac 662 849 3.54e-124 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172855
SMART Domains Protein: ENSMUSP00000133650
Gene: ENSMUSG00000024151

DomainStartEndE-ValueType
Pfam:MutS_I 13 129 3.8e-22 PFAM
Pfam:MutS_II 103 193 2.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174240
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus is frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). When cloned, it was discovered to be a human homolog of the E. coli mismatch repair gene mutS, consistent with the characteristic alterations in microsatellite sequences (RER+ phenotype) found in HNPCC. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a number of different targeted mutations develop lymphomas. In addition, depending on the allele, mutants may show intestinal adenocarcinomas and reduced class switch recombination or adenocarcinomas and abnormal mismatch repair or squamous cell carcinomas and skin tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,773,582 S223P probably damaging Het
Abcc1 G T 16: 14,394,031 V157L probably benign Het
Actn1 G A 12: 80,171,799 T737I possibly damaging Het
Ada T C 2: 163,732,948 K90E possibly damaging Het
Ap2b1 T A 11: 83,333,011 L184* probably null Het
Arfgef3 T C 10: 18,646,199 D693G probably damaging Het
Arid4a A T 12: 71,069,964 I277F probably damaging Het
BC003331 C T 1: 150,384,487 V127I probably benign Het
Ccdc171 A G 4: 83,549,618 S67G probably benign Het
Ccr5 T A 9: 124,124,502 F47L probably benign Het
Clip4 T A 17: 71,810,867 C302* probably null Het
Cyth1 C T 11: 118,184,985 V142I possibly damaging Het
Ddx59 T A 1: 136,439,742 probably null Het
Def6 G T 17: 28,228,147 R584L probably benign Het
Dnah7c C A 1: 46,514,583 Y340* probably null Het
Eif2ak4 T G 2: 118,417,338 C173W probably damaging Het
Gm14403 C T 2: 177,508,635 H125Y probably benign Het
Grk3 T C 5: 112,941,718 I323V possibly damaging Het
Homez G T 14: 54,857,030 T407K probably damaging Het
Igdcc4 A G 9: 65,130,628 T763A probably damaging Het
Ighg2b A T 12: 113,306,484 W305R unknown Het
Il27ra G T 8: 84,036,409 N296K probably damaging Het
Lzic G T 4: 149,488,104 L50F probably damaging Het
Mbtd1 T C 11: 93,921,419 V183A probably damaging Het
Mme T A 3: 63,380,272 D731E probably benign Het
Mocos T C 18: 24,654,038 L38P probably damaging Het
Mrps18a T C 17: 46,117,973 probably null Het
Mug1 A T 6: 121,857,351 I364F probably benign Het
Mycbp2 G T 14: 103,177,313 S2554R probably benign Het
Nat10 A G 2: 103,754,070 C121R probably damaging Het
Nfatc3 T A 8: 106,079,073 D183E probably damaging Het
Olfr1162 T C 2: 88,050,479 I48M probably benign Het
Olfr1426 T C 19: 12,087,941 I284V possibly damaging Het
Olfr616 A T 7: 103,564,432 F282L probably damaging Het
Olfr648 C A 7: 104,179,429 probably null Het
Pak6 T A 2: 118,696,540 I672K probably damaging Het
Pan3 A T 5: 147,543,173 I830F probably damaging Het
Pcdh9 A T 14: 93,888,192 L181I probably damaging Het
Pigg G A 5: 108,332,690 A447T probably benign Het
Pitpnb T A 5: 111,371,348 S165T probably damaging Het
Pla2g2a A G 4: 138,833,279 Y67C probably damaging Het
Plch1 A G 3: 63,781,507 I80T probably damaging Het
Pnma1 A G 12: 84,147,461 I156T probably benign Het
Prss21 G T 17: 23,872,822 D255Y possibly damaging Het
Prune1 T A 3: 95,262,331 I187F possibly damaging Het
Rab7b T C 1: 131,705,647 F78L probably benign Het
Riok3 T A 18: 12,136,787 Y92N probably benign Het
Rpap2 T C 5: 107,620,495 S400P probably benign Het
Ryr3 C A 2: 112,875,133 G792V probably damaging Het
Sept3 A G 15: 82,285,891 E206G probably damaging Het
Stkld1 T C 2: 26,950,667 S454P probably damaging Het
Tdh A T 14: 63,495,877 L140Q probably damaging Het
Tex15 T A 8: 33,557,373 H159Q probably damaging Het
Tmed6 C T 8: 107,064,161 V85I probably benign Het
Vmn1r174 T A 7: 23,754,779 L290* probably null Het
Vmn1r31 A G 6: 58,472,611 S90P probably damaging Het
Vmn2r55 T C 7: 12,670,895 T194A probably damaging Het
Vmn2r82 A T 10: 79,356,714 I42F probably damaging Het
Vps35 G A 8: 85,287,702 P106L probably damaging Het
Xrcc6 T A 15: 82,022,460 Y69N probably damaging Het
Zbtb14 C T 17: 69,388,470 P388S probably damaging Het
Zfp541 C T 7: 16,083,336 A902V probably benign Het
Other mutations in Msh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01405:Msh2 APN 17 87678235 missense probably damaging 1.00
IGL01602:Msh2 APN 17 87696489 unclassified probably benign
IGL01605:Msh2 APN 17 87696489 unclassified probably benign
IGL01775:Msh2 APN 17 87682646 missense possibly damaging 0.94
IGL02243:Msh2 APN 17 87678368 splice site probably benign
IGL02524:Msh2 APN 17 87678357 missense probably benign 0.01
IGL02730:Msh2 APN 17 87707215 missense probably damaging 1.00
IGL02743:Msh2 APN 17 87707215 missense probably damaging 1.00
IGL03049:Msh2 APN 17 87708509 missense probably damaging 1.00
IGL03282:Msh2 APN 17 87689002 missense probably benign 0.00
IGL03286:Msh2 APN 17 87682667 missense possibly damaging 0.92
R0011:Msh2 UTSW 17 87680093 intron probably benign
R0363:Msh2 UTSW 17 87717476 missense probably benign 0.30
R0520:Msh2 UTSW 17 87717544 missense possibly damaging 0.77
R0633:Msh2 UTSW 17 87672810 splice site probably null
R0862:Msh2 UTSW 17 87680052 missense probably benign
R0864:Msh2 UTSW 17 87680052 missense probably benign
R1146:Msh2 UTSW 17 87680060 missense probably benign 0.00
R1146:Msh2 UTSW 17 87680060 missense probably benign 0.00
R1264:Msh2 UTSW 17 87707179 splice site probably null
R1459:Msh2 UTSW 17 87678343 missense probably benign 0.01
R1572:Msh2 UTSW 17 87718652 missense possibly damaging 0.89
R1592:Msh2 UTSW 17 87680013 splice site probably null
R1647:Msh2 UTSW 17 87672636 missense probably benign
R1984:Msh2 UTSW 17 87719296 missense probably damaging 1.00
R2298:Msh2 UTSW 17 87708502 missense probably damaging 0.99
R2871:Msh2 UTSW 17 87685584 missense possibly damaging 0.61
R2871:Msh2 UTSW 17 87685584 missense possibly damaging 0.61
R4383:Msh2 UTSW 17 87689138 missense probably benign 0.00
R4411:Msh2 UTSW 17 87717604 missense probably damaging 0.97
R4598:Msh2 UTSW 17 87708578 missense probably damaging 1.00
R4599:Msh2 UTSW 17 87708578 missense probably damaging 1.00
R4712:Msh2 UTSW 17 87678385 intron probably benign
R4714:Msh2 UTSW 17 87718789 missense probably damaging 1.00
R4834:Msh2 UTSW 17 87723413 missense probably benign
R4842:Msh2 UTSW 17 87723413 missense probably benign
R4859:Msh2 UTSW 17 87718759 missense possibly damaging 0.94
R5007:Msh2 UTSW 17 87723413 missense probably benign
R5008:Msh2 UTSW 17 87723413 missense probably benign
R5010:Msh2 UTSW 17 87723413 missense probably benign
R5014:Msh2 UTSW 17 87717576 missense possibly damaging 0.83
R5048:Msh2 UTSW 17 87672768 missense probably damaging 1.00
R5133:Msh2 UTSW 17 87723413 missense probably benign
R5162:Msh2 UTSW 17 87723413 missense probably benign
R5163:Msh2 UTSW 17 87723413 missense probably benign
R5183:Msh2 UTSW 17 87723413 missense probably benign
R5184:Msh2 UTSW 17 87723413 missense probably benign
R5597:Msh2 UTSW 17 87723361 missense probably benign 0.04
R5655:Msh2 UTSW 17 87719443 missense possibly damaging 0.82
R5973:Msh2 UTSW 17 87708583 missense probably damaging 1.00
R6191:Msh2 UTSW 17 87723472 missense probably benign 0.03
R6632:Msh2 UTSW 17 87712666 missense possibly damaging 0.49
R7260:Msh2 UTSW 17 87717619 missense probably damaging 0.97
R7358:Msh2 UTSW 17 87717529 missense possibly damaging 0.89
X0058:Msh2 UTSW 17 87679934 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCTTCCGTTGGCGTTATG -3'
(R):5'- TCATCAGCTGGAACCACAG -3'

Sequencing Primer
(F):5'- GCGTTATGGGTATTAAAATGGCC -3'
(R):5'- TAGCATCCAGAGCTCAGTGC -3'
Posted On2015-09-24