Incidental Mutation 'R4590:BC003331'
ID342719
Institutional Source Beutler Lab
Gene Symbol BC003331
Ensembl Gene ENSMUSG00000006010
Gene NamecDNA sequence BC003331
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.570) question?
Stock #R4590 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location150361305-150393080 bp(-) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) A to G at 150386352 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006167] [ENSMUST00000006167] [ENSMUST00000094477] [ENSMUST00000097546] [ENSMUST00000097546] [ENSMUST00000097547] [ENSMUST00000097547] [ENSMUST00000111913] [ENSMUST00000111913]
Predicted Effect probably null
Transcript: ENSMUST00000006167
SMART Domains Protein: ENSMUSP00000006167
Gene: ENSMUSG00000006010

DomainStartEndE-ValueType
Pfam:ODR4-like 28 364 1.8e-107 PFAM
transmembrane domain 402 424 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000006167
SMART Domains Protein: ENSMUSP00000006167
Gene: ENSMUSG00000006010

DomainStartEndE-ValueType
Pfam:ODR4-like 28 364 1.8e-107 PFAM
transmembrane domain 402 424 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094477
SMART Domains Protein: ENSMUSP00000092050
Gene: ENSMUSG00000006010

DomainStartEndE-ValueType
Pfam:ODR4-like 28 383 2.8e-120 PFAM
transmembrane domain 424 446 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000097546
SMART Domains Protein: ENSMUSP00000095152
Gene: ENSMUSG00000006010

DomainStartEndE-ValueType
Pfam:ODR4-like 28 364 1.8e-107 PFAM
transmembrane domain 402 424 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000097546
SMART Domains Protein: ENSMUSP00000095152
Gene: ENSMUSG00000006010

DomainStartEndE-ValueType
Pfam:ODR4-like 28 364 1.8e-107 PFAM
transmembrane domain 402 424 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000097547
SMART Domains Protein: ENSMUSP00000095153
Gene: ENSMUSG00000006010

DomainStartEndE-ValueType
Pfam:ODR4-like 28 209 1.2e-57 PFAM
Pfam:ODR4-like 206 354 3.1e-43 PFAM
transmembrane domain 392 414 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000097547
SMART Domains Protein: ENSMUSP00000095153
Gene: ENSMUSG00000006010

DomainStartEndE-ValueType
Pfam:ODR4-like 28 209 1.2e-57 PFAM
Pfam:ODR4-like 206 354 3.1e-43 PFAM
transmembrane domain 392 414 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111913
SMART Domains Protein: ENSMUSP00000107544
Gene: ENSMUSG00000006010

DomainStartEndE-ValueType
Pfam:ODR4-like 28 386 7.1e-113 PFAM
transmembrane domain 424 446 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111913
SMART Domains Protein: ENSMUSP00000107544
Gene: ENSMUSG00000006010

DomainStartEndE-ValueType
Pfam:ODR4-like 28 386 7.1e-113 PFAM
transmembrane domain 424 446 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148389
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150615
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 T A 18: 36,583,644 D201E probably damaging Het
Ano10 T A 9: 122,257,165 Q398L probably benign Het
Ap3d1 A T 10: 80,719,812 L319* probably null Het
Cacna1e T C 1: 154,436,519 M1575V possibly damaging Het
Cep192 T A 18: 67,816,791 Y315* probably null Het
Cndp2 C A 18: 84,669,808 V353F probably damaging Het
Ctsq T A 13: 61,036,214 N298I probably benign Het
Dnah6 A T 6: 73,152,712 C1173S probably damaging Het
Dnah9 T C 11: 66,040,392 M1993V probably damaging Het
Dnhd1 T C 7: 105,714,030 V3933A probably damaging Het
Dnpep C A 1: 75,316,401 V76L probably damaging Het
Dsc3 A C 18: 19,989,695 C57W probably damaging Het
Dtx3 A G 10: 127,192,695 S222P probably damaging Het
Eml5 T C 12: 98,837,341 Y1009C possibly damaging Het
Fam169a A G 13: 97,097,585 I122V probably benign Het
Fgr T A 4: 132,995,053 V211E probably damaging Het
Flvcr1 T C 1: 191,012,146 T402A probably benign Het
Frmd5 C T 2: 121,765,031 probably null Het
Fut2 T C 7: 45,650,946 N134S possibly damaging Het
Gm10110 A T 14: 89,897,546 noncoding transcript Het
Gm7275 A T 16: 48,073,619 noncoding transcript Het
Gm904 T A 13: 50,645,249 C81* probably null Het
Herc1 T A 9: 66,437,664 V1913E probably damaging Het
Hnmt T C 2: 24,019,099 probably null Het
Ift172 T C 5: 31,253,955 E1643G probably damaging Het
Inpp4b T A 8: 81,741,411 M1K probably null Het
Keap1 G T 9: 21,237,609 A34D probably damaging Het
Krt25 T C 11: 99,318,028 probably benign Het
Lama2 A G 10: 26,989,414 V2916A probably benign Het
Ly9 G A 1: 171,593,875 Q603* probably null Het
Mis18bp1 A C 12: 65,158,506 N14K possibly damaging Het
Mmrn1 G T 6: 60,960,813 C265F probably damaging Het
Mrgprb5 C T 7: 48,168,061 E309K probably benign Het
Nrtn T C 17: 56,751,504 T166A probably damaging Het
Olfr150 T C 9: 39,736,850 F12L probably damaging Het
Osbpl7 T A 11: 97,056,272 S266R probably damaging Het
Pcdhb11 T C 18: 37,422,496 I293T probably damaging Het
Pes1 A G 11: 3,977,986 Y546C probably damaging Het
Pth1r A T 9: 110,722,271 W587R probably benign Het
Rasgrf2 A G 13: 92,038,281 Y147H probably damaging Het
Rbbp8 T A 18: 11,732,265 L737* probably null Het
Rcor3 A T 1: 192,125,917 F153L probably damaging Het
Rev3l G A 10: 39,806,933 C349Y probably damaging Het
Rnf115 C T 3: 96,788,573 T225M probably benign Het
Rnf157 A G 11: 116,359,272 V200A probably damaging Het
Scfd2 T C 5: 74,212,256 T653A probably benign Het
Sdccag8 T C 1: 176,948,292 Y590H probably damaging Het
Sema4d T A 13: 51,723,618 K59N probably benign Het
Serpinb7 C A 1: 107,451,833 H323Q probably damaging Het
Setx T A 2: 29,144,809 H435Q probably damaging Het
Sgk3 T C 1: 9,898,795 S466P possibly damaging Het
Sgsm2 T C 11: 74,851,132 M1011V probably damaging Het
Ssc4d G A 5: 135,964,684 P106L probably benign Het
Taf7 T C 18: 37,642,731 Q261R possibly damaging Het
Tbc1d2b T C 9: 90,270,500 K71R possibly damaging Het
Tff3 C T 17: 31,129,534 V15I probably benign Het
Tgfb3 C A 12: 86,077,815 V40L possibly damaging Het
Timm10 T A 2: 84,827,648 D2E possibly damaging Het
Ttc16 T A 2: 32,773,741 N74I probably damaging Het
Ttll1 G A 15: 83,497,345 T241I probably damaging Het
Uba6 T A 5: 86,112,744 D992V probably damaging Het
Vmn1r25 T A 6: 57,978,495 T270S probably benign Het
Vmn2r106 T C 17: 20,277,466 I504V probably damaging Het
Vmn2r87 G T 10: 130,479,145 H191N possibly damaging Het
Vnn1 C A 10: 23,899,405 F184L possibly damaging Het
Vtn A T 11: 78,502,206 I466F probably damaging Het
Zfp352 A C 4: 90,224,535 D304A probably damaging Het
Other mutations in BC003331
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01876:BC003331 APN 1 150382338 missense probably benign 0.10
IGL02189:BC003331 APN 1 150372033 missense possibly damaging 0.94
IGL02257:BC003331 APN 1 150386404 missense probably damaging 0.99
IGL02485:BC003331 APN 1 150363489 critical splice donor site probably null
IGL02585:BC003331 APN 1 150363521 missense probably damaging 0.96
IGL02712:BC003331 APN 1 150386356 critical splice donor site probably null
IGL02902:BC003331 APN 1 150384428 critical splice donor site probably null
IGL03014:BC003331 APN 1 150383053 splice site probably benign
IGL03124:BC003331 APN 1 150386425 missense probably benign 0.00
IGL03181:BC003331 APN 1 150363539 missense probably benign 0.06
IGL03344:BC003331 APN 1 150363544 missense probably damaging 0.99
R1170:BC003331 UTSW 1 150386391 missense probably benign 0.00
R1796:BC003331 UTSW 1 150375554 missense probably benign
R1902:BC003331 UTSW 1 150388609 unclassified probably null
R2149:BC003331 UTSW 1 150388559 missense probably benign 0.05
R2155:BC003331 UTSW 1 150382335 missense possibly damaging 0.68
R2375:BC003331 UTSW 1 150390234 critical splice donor site probably null
R3786:BC003331 UTSW 1 150384531 missense probably benign 0.21
R3948:BC003331 UTSW 1 150388557 nonsense probably null
R4589:BC003331 UTSW 1 150384487 missense probably benign 0.11
R4815:BC003331 UTSW 1 150374846 missense probably damaging 0.99
R5196:BC003331 UTSW 1 150382389 missense probably damaging 1.00
R5437:BC003331 UTSW 1 150363518 missense probably benign 0.01
R5549:BC003331 UTSW 1 150372158 missense possibly damaging 0.86
R5677:BC003331 UTSW 1 150374837 missense probably damaging 1.00
R5896:BC003331 UTSW 1 150380360 missense probably benign 0.10
R6472:BC003331 UTSW 1 150381522 missense probably benign 0.15
R7108:BC003331 UTSW 1 150382290 missense probably benign 0.01
R7402:BC003331 UTSW 1 150386356 critical splice donor site probably null
R7662:BC003331 UTSW 1 150382294 missense probably benign
R7767:BC003331 UTSW 1 150372037 missense probably benign 0.00
R7810:BC003331 UTSW 1 150392908 utr 5 prime probably benign
Predicted Primers PCR Primer
(F):5'- CTTCCTAGTGAGTGGAAGGTC -3'
(R):5'- CCTGGATTGGTCCTGTATGC -3'

Sequencing Primer
(F):5'- GAACCTGAAAAGTTGGCATCCTCTG -3'
(R):5'- GGTCCTGTATGCATAATTTGTCC -3'
Posted On2015-09-24