Incidental Mutation 'R0346:Abca16'
ID 34273
Institutional Source Beutler Lab
Gene Symbol Abca16
Ensembl Gene ENSMUSG00000051900
Gene Name ATP-binding cassette, sub-family A member 16
Synonyms
MMRRC Submission 038553-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0346 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 120008870-120144036 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 120035155 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 314 (C314S)
Ref Sequence ENSEMBL: ENSMUSP00000061094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056042] [ENSMUST00000120490]
AlphaFold E9PWJ7
Predicted Effect probably damaging
Transcript: ENSMUST00000056042
AA Change: C314S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061094
Gene: ENSMUSG00000051900
AA Change: C314S

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 26 455 2.7e-23 PFAM
AAA 537 720 2.01e-7 SMART
Pfam:ABC2_membrane_3 898 1287 4.6e-25 PFAM
low complexity region 1325 1336 N/A INTRINSIC
low complexity region 1342 1353 N/A INTRINSIC
AAA 1378 1563 4.23e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120490
AA Change: C314S

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112736
Gene: ENSMUSG00000051900
AA Change: C314S

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 25 456 2.4e-22 PFAM
AAA 538 721 2.01e-7 SMART
Pfam:ABC2_membrane_3 899 1288 1.1e-27 PFAM
low complexity region 1326 1337 N/A INTRINSIC
low complexity region 1343 1354 N/A INTRINSIC
AAA 1379 1564 4.23e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144122
SMART Domains Protein: ENSMUSP00000114975
Gene: ENSMUSG00000051900

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 2 133 1e-16 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.4%
Validation Efficiency 100% (79/79)
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,516,278 (GRCm39) I4406L probably damaging Het
Add3 C T 19: 53,205,387 (GRCm39) R46* probably null Het
Alas1 A T 9: 106,120,550 (GRCm39) S82T possibly damaging Het
Alkbh5 C G 11: 60,429,567 (GRCm39) R107G possibly damaging Het
Ap3b1 A T 13: 94,582,479 (GRCm39) R365* probably null Het
Ass1 A T 2: 31,404,831 (GRCm39) N371Y probably damaging Het
AU021092 T C 16: 5,034,718 (GRCm39) D168G possibly damaging Het
Bcl2 G A 1: 106,640,292 (GRCm39) R107C probably damaging Het
Caln1 C A 5: 130,851,762 (GRCm39) H184N possibly damaging Het
Camta1 C A 4: 151,159,597 (GRCm39) R1614L probably damaging Het
Ccdc191 T C 16: 43,759,315 (GRCm39) V372A probably damaging Het
Ccng2 T G 5: 93,418,753 (GRCm39) I126S probably damaging Het
Cep85 A T 4: 133,859,733 (GRCm39) N643K probably damaging Het
Clvs2 G C 10: 33,498,542 (GRCm39) S129R possibly damaging Het
Cntn1 G T 15: 92,129,968 (GRCm39) probably benign Het
Cttn A T 7: 144,006,276 (GRCm39) probably benign Het
Dedd2 T C 7: 24,910,694 (GRCm39) S161G possibly damaging Het
Dnajb13 T C 7: 100,153,132 (GRCm39) D263G probably damaging Het
Dppa4 T A 16: 48,109,687 (GRCm39) probably benign Het
Ear2 A G 14: 44,340,363 (GRCm39) E7G probably damaging Het
Eif2b4 A G 5: 31,345,452 (GRCm39) probably benign Het
Etl4 G T 2: 20,764,463 (GRCm39) probably null Het
Fbxo15 T A 18: 84,978,346 (GRCm39) probably null Het
Gm9970 A G 5: 31,398,182 (GRCm39) probably benign Het
Hap1 A G 11: 100,246,855 (GRCm39) S17P probably benign Het
Hgd C T 16: 37,409,136 (GRCm39) probably benign Het
Ift56 T C 6: 38,386,370 (GRCm39) C364R probably damaging Het
Inpp5f T A 7: 128,292,392 (GRCm39) L16Q probably damaging Het
Irag1 T C 7: 110,498,183 (GRCm39) D404G probably damaging Het
Islr2 G A 9: 58,105,626 (GRCm39) R545* probably null Het
Itgav G T 2: 83,622,953 (GRCm39) C675F probably damaging Het
Kif13a T A 13: 46,967,695 (GRCm39) I403L possibly damaging Het
Kif14 T A 1: 136,395,898 (GRCm39) I68N probably damaging Het
Kif26a G T 12: 112,145,782 (GRCm39) K1764N probably null Het
Lrrd1 C A 5: 3,900,215 (GRCm39) F173L probably benign Het
Mroh4 G C 15: 74,486,141 (GRCm39) probably benign Het
Msh5 A G 17: 35,248,864 (GRCm39) V723A probably benign Het
Mybph T G 1: 134,125,492 (GRCm39) I279S probably damaging Het
Myh4 A T 11: 67,151,152 (GRCm39) I1936L probably benign Het
Myo1h A T 5: 114,493,270 (GRCm39) T704S probably benign Het
Nav2 C A 7: 49,254,333 (GRCm39) T2377K probably benign Het
Nipbl T G 15: 8,390,440 (GRCm39) Q276H probably damaging Het
Nlrp9b T C 7: 19,758,440 (GRCm39) L559P probably damaging Het
Nup210l T A 3: 90,096,745 (GRCm39) V1318E probably damaging Het
Or1e26 A G 11: 73,480,283 (GRCm39) Y94H probably damaging Het
Or4z4 A T 19: 12,076,803 (GRCm39) S67T probably damaging Het
Or6c8b C A 10: 128,882,342 (GRCm39) V197F possibly damaging Het
Or7e178 A G 9: 20,225,707 (GRCm39) S170P probably benign Het
P2ry13 T C 3: 59,116,987 (GRCm39) T264A possibly damaging Het
Plekhg5 T C 4: 152,198,710 (GRCm39) L966P probably benign Het
Prss35 A G 9: 86,637,404 (GRCm39) K58R probably benign Het
Ptafr T A 4: 132,307,390 (GRCm39) L260* probably null Het
Pum1 A T 4: 130,507,116 (GRCm39) T1157S possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Rnf145 A G 11: 44,445,991 (GRCm39) Y275C probably damaging Het
Rpl6 A T 5: 121,346,554 (GRCm39) K218N possibly damaging Het
Rps6 T C 4: 86,774,218 (GRCm39) T128A probably benign Het
Ryr1 G T 7: 28,767,013 (GRCm39) probably benign Het
Scel A T 14: 103,767,420 (GRCm39) Q26H probably damaging Het
Sfxn4 A T 19: 60,847,111 (GRCm39) D57E probably benign Het
Slc35d1 A C 4: 103,048,044 (GRCm39) L240R probably damaging Het
Smcr8 A G 11: 60,670,576 (GRCm39) I575V probably benign Het
Spata31e4 T C 13: 50,857,346 (GRCm39) Y995H probably benign Het
Syk G A 13: 52,794,695 (GRCm39) M476I probably damaging Het
Tbcel A T 9: 42,348,539 (GRCm39) probably benign Het
Tob2 C A 15: 81,742,424 (GRCm39) G65W probably damaging Het
Trim16 A G 11: 62,731,520 (GRCm39) N464D probably benign Het
Trim36 T C 18: 46,332,776 (GRCm39) probably benign Het
Trpv4 C A 5: 114,768,590 (GRCm39) probably benign Het
Tsga10 T A 1: 37,879,600 (GRCm39) T64S possibly damaging Het
Vars2 A T 17: 35,975,756 (GRCm39) probably benign Het
Vmn1r72 C A 7: 11,403,621 (GRCm39) V276L probably benign Het
Vps13a T A 19: 16,655,333 (GRCm39) K1898N probably benign Het
Vps18 A G 2: 119,127,645 (GRCm39) M823V probably damaging Het
Washc2 T C 6: 116,197,484 (GRCm39) probably benign Het
Zfp763 A T 17: 33,238,721 (GRCm39) H141Q probably benign Het
Other mutations in Abca16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Abca16 APN 7 120,022,982 (GRCm39) missense probably benign 0.08
IGL00590:Abca16 APN 7 120,023,038 (GRCm39) missense probably damaging 1.00
IGL01320:Abca16 APN 7 120,038,422 (GRCm39) missense probably damaging 1.00
IGL01322:Abca16 APN 7 120,038,422 (GRCm39) missense probably damaging 1.00
IGL01613:Abca16 APN 7 120,140,500 (GRCm39) missense probably benign 0.03
IGL01774:Abca16 APN 7 120,021,024 (GRCm39) splice site probably benign
IGL01774:Abca16 APN 7 120,077,058 (GRCm39) missense probably damaging 1.00
IGL01797:Abca16 APN 7 120,113,760 (GRCm39) missense probably benign 0.15
IGL02406:Abca16 APN 7 120,139,825 (GRCm39) missense probably damaging 1.00
IGL02437:Abca16 APN 7 120,132,952 (GRCm39) missense probably benign 0.00
IGL02541:Abca16 APN 7 120,113,881 (GRCm39) missense possibly damaging 0.91
IGL02576:Abca16 APN 7 120,032,678 (GRCm39) missense probably benign 0.05
IGL02578:Abca16 APN 7 120,023,179 (GRCm39) critical splice donor site probably null
IGL03156:Abca16 APN 7 120,023,074 (GRCm39) missense possibly damaging 0.69
IGL03381:Abca16 APN 7 120,127,041 (GRCm39) missense probably benign 0.12
PIT4802001:Abca16 UTSW 7 120,139,351 (GRCm39) missense probably benign 0.31
R0024:Abca16 UTSW 7 120,032,608 (GRCm39) missense probably damaging 1.00
R0026:Abca16 UTSW 7 120,077,146 (GRCm39) splice site probably benign
R0026:Abca16 UTSW 7 120,077,146 (GRCm39) splice site probably benign
R0123:Abca16 UTSW 7 120,139,378 (GRCm39) missense probably damaging 1.00
R0134:Abca16 UTSW 7 120,139,378 (GRCm39) missense probably damaging 1.00
R0225:Abca16 UTSW 7 120,139,378 (GRCm39) missense probably damaging 1.00
R0355:Abca16 UTSW 7 120,023,021 (GRCm39) missense possibly damaging 0.68
R0358:Abca16 UTSW 7 120,143,939 (GRCm39) missense probably benign 0.01
R0525:Abca16 UTSW 7 120,065,033 (GRCm39) nonsense probably null
R0617:Abca16 UTSW 7 120,032,834 (GRCm39) splice site probably benign
R0625:Abca16 UTSW 7 120,035,116 (GRCm39) missense probably damaging 1.00
R0835:Abca16 UTSW 7 120,065,007 (GRCm39) missense probably benign 0.42
R1445:Abca16 UTSW 7 120,119,256 (GRCm39) missense probably benign 0.41
R1535:Abca16 UTSW 7 120,139,928 (GRCm39) missense probably benign 0.30
R1567:Abca16 UTSW 7 120,030,352 (GRCm39) missense probably benign 0.08
R1694:Abca16 UTSW 7 120,119,307 (GRCm39) missense probably damaging 1.00
R1860:Abca16 UTSW 7 120,133,986 (GRCm39) missense probably benign 0.02
R1876:Abca16 UTSW 7 120,032,608 (GRCm39) missense probably damaging 1.00
R1913:Abca16 UTSW 7 120,140,463 (GRCm39) missense probably benign 0.04
R1940:Abca16 UTSW 7 120,032,832 (GRCm39) splice site probably benign
R2042:Abca16 UTSW 7 120,143,941 (GRCm39) missense probably benign
R2115:Abca16 UTSW 7 120,139,868 (GRCm39) missense probably damaging 1.00
R2122:Abca16 UTSW 7 120,119,184 (GRCm39) missense probably damaging 1.00
R2265:Abca16 UTSW 7 120,030,383 (GRCm39) missense probably benign 0.03
R2267:Abca16 UTSW 7 120,030,383 (GRCm39) missense probably benign 0.03
R2269:Abca16 UTSW 7 120,030,383 (GRCm39) missense probably benign 0.03
R2993:Abca16 UTSW 7 120,134,384 (GRCm39) missense probably damaging 1.00
R3055:Abca16 UTSW 7 120,035,074 (GRCm39) missense probably benign 0.05
R3956:Abca16 UTSW 7 120,126,975 (GRCm39) missense probably damaging 0.96
R4114:Abca16 UTSW 7 120,126,290 (GRCm39) missense probably benign 0.06
R4441:Abca16 UTSW 7 120,127,024 (GRCm39) missense probably benign 0.04
R4601:Abca16 UTSW 7 120,035,920 (GRCm39) missense probably damaging 0.98
R4706:Abca16 UTSW 7 120,064,988 (GRCm39) missense probably damaging 1.00
R4807:Abca16 UTSW 7 120,139,832 (GRCm39) missense probably damaging 1.00
R4824:Abca16 UTSW 7 120,074,702 (GRCm39) missense possibly damaging 0.86
R4937:Abca16 UTSW 7 120,126,309 (GRCm39) missense probably damaging 0.98
R5152:Abca16 UTSW 7 120,139,846 (GRCm39) missense probably benign 0.02
R5257:Abca16 UTSW 7 120,035,992 (GRCm39) critical splice donor site probably null
R5258:Abca16 UTSW 7 120,035,992 (GRCm39) critical splice donor site probably null
R5330:Abca16 UTSW 7 120,102,600 (GRCm39) missense probably benign 0.15
R5388:Abca16 UTSW 7 120,139,969 (GRCm39) critical splice donor site probably null
R5590:Abca16 UTSW 7 120,143,995 (GRCm39) missense probably damaging 0.98
R5810:Abca16 UTSW 7 120,035,155 (GRCm39) missense probably damaging 1.00
R6030:Abca16 UTSW 7 120,133,021 (GRCm39) missense probably benign
R6030:Abca16 UTSW 7 120,133,021 (GRCm39) missense probably benign
R6161:Abca16 UTSW 7 120,139,934 (GRCm39) missense probably damaging 1.00
R6313:Abca16 UTSW 7 120,126,344 (GRCm39) missense probably damaging 1.00
R6485:Abca16 UTSW 7 120,026,390 (GRCm39) nonsense probably null
R6527:Abca16 UTSW 7 120,076,995 (GRCm39) missense possibly damaging 0.95
R6772:Abca16 UTSW 7 120,126,276 (GRCm39) missense probably damaging 1.00
R6885:Abca16 UTSW 7 120,119,332 (GRCm39) missense probably benign 0.07
R6899:Abca16 UTSW 7 120,126,264 (GRCm39) missense probably damaging 1.00
R6941:Abca16 UTSW 7 120,140,370 (GRCm39) missense probably damaging 1.00
R6990:Abca16 UTSW 7 120,126,950 (GRCm39) missense probably benign 0.00
R7059:Abca16 UTSW 7 120,020,971 (GRCm39) missense probably benign 0.00
R7144:Abca16 UTSW 7 120,032,796 (GRCm39) missense possibly damaging 0.89
R7146:Abca16 UTSW 7 120,126,974 (GRCm39) missense possibly damaging 0.46
R7193:Abca16 UTSW 7 120,026,409 (GRCm39) missense probably damaging 1.00
R7308:Abca16 UTSW 7 120,022,993 (GRCm39) missense probably benign 0.01
R7449:Abca16 UTSW 7 120,035,131 (GRCm39) missense possibly damaging 0.95
R7571:Abca16 UTSW 7 120,119,211 (GRCm39) missense probably benign 0.11
R7617:Abca16 UTSW 7 120,102,694 (GRCm39) nonsense probably null
R7646:Abca16 UTSW 7 120,113,937 (GRCm39) missense probably benign 0.04
R7750:Abca16 UTSW 7 120,113,928 (GRCm39) missense probably benign 0.09
R7763:Abca16 UTSW 7 120,113,825 (GRCm39) missense probably damaging 1.00
R7840:Abca16 UTSW 7 120,074,689 (GRCm39) missense probably benign 0.00
R7946:Abca16 UTSW 7 120,126,398 (GRCm39) missense probably benign 0.01
R8018:Abca16 UTSW 7 120,132,866 (GRCm39) missense probably benign 0.04
R8170:Abca16 UTSW 7 120,065,005 (GRCm39) missense probably damaging 1.00
R8413:Abca16 UTSW 7 120,023,123 (GRCm39) missense probably benign 0.06
R8461:Abca16 UTSW 7 120,035,918 (GRCm39) missense possibly damaging 0.95
R8858:Abca16 UTSW 7 120,052,327 (GRCm39) missense probably benign
R8881:Abca16 UTSW 7 120,074,794 (GRCm39) missense probably benign 0.18
R9272:Abca16 UTSW 7 120,076,993 (GRCm39) missense probably benign 0.13
R9303:Abca16 UTSW 7 120,126,989 (GRCm39) missense probably benign 0.25
R9305:Abca16 UTSW 7 120,126,989 (GRCm39) missense probably benign 0.25
R9320:Abca16 UTSW 7 120,139,320 (GRCm39) missense probably damaging 0.98
R9413:Abca16 UTSW 7 120,126,422 (GRCm39) missense probably benign 0.01
R9512:Abca16 UTSW 7 120,022,963 (GRCm39) missense probably benign 0.01
R9559:Abca16 UTSW 7 120,021,019 (GRCm39) critical splice donor site probably null
R9615:Abca16 UTSW 7 120,126,404 (GRCm39) missense probably benign 0.01
R9641:Abca16 UTSW 7 120,126,308 (GRCm39) missense possibly damaging 0.52
R9643:Abca16 UTSW 7 120,065,023 (GRCm39) missense possibly damaging 0.96
R9674:Abca16 UTSW 7 120,074,668 (GRCm39) critical splice acceptor site probably null
R9714:Abca16 UTSW 7 120,030,383 (GRCm39) missense probably benign 0.01
R9799:Abca16 UTSW 7 120,132,998 (GRCm39) missense probably benign 0.00
R9800:Abca16 UTSW 7 120,119,283 (GRCm39) missense possibly damaging 0.68
RF020:Abca16 UTSW 7 120,132,880 (GRCm39) missense possibly damaging 0.90
X0066:Abca16 UTSW 7 120,102,609 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTGTGAAAGCATCATGAATTGCCTGAC -3'
(R):5'- TGTGTAGCAGACTCAACTCACTGAAAC -3'

Sequencing Primer
(F):5'- aattgcctgacatataaaatgcttg -3'
(R):5'- acctgaaatacagcttgaatgac -3'
Protein Function and Prediction

Abca16 encodes ABCA16, a member of the ATP-binding cassette (ABC) transporter superfamily.  The members of the ABCA subfamily share a high degree of sequence conservation and function in lipid trafficking in several body locations. Abca16 has been cloned rat and mouse; no human orthologue has been described. The ABCA16 has two nucleotide-binding folds and two transmembrane domains.  Abca16 is predominantly expressed in testis, indicating that it may function in testicular development or spermatogenesis. 

Posted On 2013-05-09