Mutagenetix > Incidental Mutation

Incidental Mutation 'R4590:Mmrn1'

342741

Institutional Source

Beutler Lab

Gene Symbol

Mmrn1

Ensembl Gene

ENSMUSG00000054641

Gene Name

multimerin 1

Synonyms

4921530G03Rik, Emilin4

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4590 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

60924976-60989378 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 60960813 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Phenylalanine at position 265 (C265F)

Ref Sequence

ENSEMBL: ENSMUSP00000145156 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000129603] [ENSMUST00000204333]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000129603
AA Change: C265F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000119609
Gene: ENSMUSG00000054641
AA Change: C265F

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
Pfam:EMI	193	262	3.3e-12	PFAM
coiled coil region	303	338	N/A	INTRINSIC
coiled coil region	658	688	N/A	INTRINSIC
coiled coil region	808	846	N/A	INTRINSIC
low complexity region	981	992	N/A	INTRINSIC
EGF	1026	1059	1.62e-5	SMART
C1Q	1076	1210	6.74e-49	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000204333
AA Change: C265F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000145156
Gene: ENSMUSG00000054641
AA Change: C265F

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
Pfam:EMI	193	262	7.7e-13	PFAM
coiled coil region	303	338	N/A	INTRINSIC
coiled coil region	658	688	N/A	INTRINSIC
coiled coil region	808	846	N/A	INTRINSIC
low complexity region	981	992	N/A	INTRINSIC
EGF	1025	1058	1.62e-5	SMART
C1Q	1075	1209	6.74e-49	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Multimerin is a massive, soluble protein found in platelets and in the endothelium of blood vessels. It is comprised of subunits linked by interchain disulfide bonds to form large, variably sized homomultimers. Multimerin is a factor V/Va-binding protein and may function as a carrier protein for platelet factor V. It may also have functions as an extracellular matrix or adhesive protein. Recently, patients with an unusual autosomal-dominant bleeding disorder (factor V Quebec) were found to have a deficiency of platelet multimerin. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankhd1	T	A	18: 36,583,644	D201E	probably damaging	Het
Ano10	T	A	9: 122,257,165	Q398L	probably benign	Het
Ap3d1	A	T	10: 80,719,812	L319*	probably null	Het
BC003331	A	G	1: 150,386,352		probably null	Het
Cacna1e	T	C	1: 154,436,519	M1575V	possibly damaging	Het
Cep192	T	A	18: 67,816,791	Y315*	probably null	Het
Cndp2	C	A	18: 84,669,808	V353F	probably damaging	Het
Ctsq	T	A	13: 61,036,214	N298I	probably benign	Het
Dnah6	A	T	6: 73,152,712	C1173S	probably damaging	Het
Dnah9	T	C	11: 66,040,392	M1993V	probably damaging	Het
Dnhd1	T	C	7: 105,714,030	V3933A	probably damaging	Het
Dnpep	C	A	1: 75,316,401	V76L	probably damaging	Het
Dsc3	A	C	18: 19,989,695	C57W	probably damaging	Het
Dtx3	A	G	10: 127,192,695	S222P	probably damaging	Het
Eml5	T	C	12: 98,837,341	Y1009C	possibly damaging	Het
Fam169a	A	G	13: 97,097,585	I122V	probably benign	Het
Fgr	T	A	4: 132,995,053	V211E	probably damaging	Het
Flvcr1	T	C	1: 191,012,146	T402A	probably benign	Het
Frmd5	C	T	2: 121,765,031		probably null	Het
Fut2	T	C	7: 45,650,946	N134S	possibly damaging	Het
Gm10110	A	T	14: 89,897,546		noncoding transcript	Het
Gm7275	A	T	16: 48,073,619		noncoding transcript	Het
Gm904	T	A	13: 50,645,249	C81*	probably null	Het
Herc1	T	A	9: 66,437,664	V1913E	probably damaging	Het
Hnmt	T	C	2: 24,019,099		probably null	Het
Ift172	T	C	5: 31,253,955	E1643G	probably damaging	Het
Inpp4b	T	A	8: 81,741,411	M1K	probably null	Het
Keap1	G	T	9: 21,237,609	A34D	probably damaging	Het
Krt25	T	C	11: 99,318,028		probably benign	Het
Lama2	A	G	10: 26,989,414	V2916A	probably benign	Het
Ly9	G	A	1: 171,593,875	Q603*	probably null	Het
Mis18bp1	A	C	12: 65,158,506	N14K	possibly damaging	Het
Mrgprb5	C	T	7: 48,168,061	E309K	probably benign	Het
Nrtn	T	C	17: 56,751,504	T166A	probably damaging	Het
Olfr150	T	C	9: 39,736,850	F12L	probably damaging	Het
Osbpl7	T	A	11: 97,056,272	S266R	probably damaging	Het
Pcdhb11	T	C	18: 37,422,496	I293T	probably damaging	Het
Pes1	A	G	11: 3,977,986	Y546C	probably damaging	Het
Pth1r	A	T	9: 110,722,271	W587R	probably benign	Het
Rasgrf2	A	G	13: 92,038,281	Y147H	probably damaging	Het
Rbbp8	T	A	18: 11,732,265	L737*	probably null	Het
Rcor3	A	T	1: 192,125,917	F153L	probably damaging	Het
Rev3l	G	A	10: 39,806,933	C349Y	probably damaging	Het
Rnf115	C	T	3: 96,788,573	T225M	probably benign	Het
Rnf157	A	G	11: 116,359,272	V200A	probably damaging	Het
Scfd2	T	C	5: 74,212,256	T653A	probably benign	Het
Sdccag8	T	C	1: 176,948,292	Y590H	probably damaging	Het
Sema4d	T	A	13: 51,723,618	K59N	probably benign	Het
Serpinb7	C	A	1: 107,451,833	H323Q	probably damaging	Het
Setx	T	A	2: 29,144,809	H435Q	probably damaging	Het
Sgk3	T	C	1: 9,898,795	S466P	possibly damaging	Het
Sgsm2	T	C	11: 74,851,132	M1011V	probably damaging	Het
Ssc4d	G	A	5: 135,964,684	P106L	probably benign	Het
Taf7	T	C	18: 37,642,731	Q261R	possibly damaging	Het
Tbc1d2b	T	C	9: 90,270,500	K71R	possibly damaging	Het
Tff3	C	T	17: 31,129,534	V15I	probably benign	Het
Tgfb3	C	A	12: 86,077,815	V40L	possibly damaging	Het
Timm10	T	A	2: 84,827,648	D2E	possibly damaging	Het
Ttc16	T	A	2: 32,773,741	N74I	probably damaging	Het
Ttll1	G	A	15: 83,497,345	T241I	probably damaging	Het
Uba6	T	A	5: 86,112,744	D992V	probably damaging	Het
Vmn1r25	T	A	6: 57,978,495	T270S	probably benign	Het
Vmn2r106	T	C	17: 20,277,466	I504V	probably damaging	Het
Vmn2r87	G	T	10: 130,479,145	H191N	possibly damaging	Het
Vnn1	C	A	10: 23,899,405	F184L	possibly damaging	Het
Vtn	A	T	11: 78,502,206	I466F	probably damaging	Het
Zfp352	A	C	4: 90,224,535	D304A	probably damaging	Het

Other mutations in Mmrn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00640:Mmrn1	APN	6	60977513	missense	probably benign
IGL00742:Mmrn1	APN	6	60958120	missense	probably damaging	1.00
IGL00917:Mmrn1	APN	6	60975910	nonsense	probably null
IGL01121:Mmrn1	APN	6	60975944	missense	possibly damaging	0.46
IGL01393:Mmrn1	APN	6	60960708	splice site	probably benign
IGL01697:Mmrn1	APN	6	60976493	missense	possibly damaging	0.46
IGL01737:Mmrn1	APN	6	60977161	missense	probably benign
IGL01944:Mmrn1	APN	6	60971183	critical splice donor site	probably null
IGL01987:Mmrn1	APN	6	60944573	missense	probably benign	0.31
IGL02005:Mmrn1	APN	6	60960744	missense	probably damaging	1.00
IGL02190:Mmrn1	APN	6	60987193	missense	probably benign	0.13
IGL02335:Mmrn1	APN	6	60977147	missense	possibly damaging	0.79
IGL02421:Mmrn1	APN	6	60944822	missense	probably benign	0.00
IGL02530:Mmrn1	APN	6	60958176	missense	possibly damaging	0.73
IGL02709:Mmrn1	APN	6	60973046	missense	probably damaging	1.00
IGL03139:Mmrn1	APN	6	60976340	missense	probably damaging	0.99
IGL03228:Mmrn1	APN	6	60944892	missense	probably benign	0.02
IGL03272:Mmrn1	APN	6	60988435	missense	probably damaging	1.00
IGL03410:Mmrn1	APN	6	60975835	missense	probably benign	0.36
H8562:Mmrn1	UTSW	6	60958180	missense	probably damaging	0.98
K2124:Mmrn1	UTSW	6	60976033	missense	possibly damaging	0.87
R0145:Mmrn1	UTSW	6	60973010	missense	probably damaging	1.00
R0164:Mmrn1	UTSW	6	60975815	splice site	probably benign
R0352:Mmrn1	UTSW	6	60944971	missense	probably benign	0.03
R0400:Mmrn1	UTSW	6	60977115	missense	probably benign	0.00
R0538:Mmrn1	UTSW	6	60976469	missense	probably benign	0.00
R0907:Mmrn1	UTSW	6	60973119	missense	probably benign	0.09
R1117:Mmrn1	UTSW	6	60976325	missense	possibly damaging	0.51
R1383:Mmrn1	UTSW	6	60976322	missense	probably damaging	1.00
R1542:Mmrn1	UTSW	6	60945118	missense	probably damaging	0.98
R1591:Mmrn1	UTSW	6	60944771	nonsense	probably null
R1599:Mmrn1	UTSW	6	60945037	missense	probably benign
R1733:Mmrn1	UTSW	6	60977101	missense	probably benign	0.00
R2005:Mmrn1	UTSW	6	60976084	missense	possibly damaging	0.88
R2056:Mmrn1	UTSW	6	60944805	missense	probably benign	0.00
R2144:Mmrn1	UTSW	6	60945075	missense	possibly damaging	0.54
R2299:Mmrn1	UTSW	6	60976441	missense	probably damaging	0.99
R3836:Mmrn1	UTSW	6	60944847	missense	probably benign
R3837:Mmrn1	UTSW	6	60944847	missense	probably benign
R4206:Mmrn1	UTSW	6	60958180	missense	probably damaging	0.98
R4414:Mmrn1	UTSW	6	60944586	missense	probably damaging	1.00
R4707:Mmrn1	UTSW	6	60988473	missense	probably benign	0.12
R4820:Mmrn1	UTSW	6	60973043	missense	probably benign	0.04
R4880:Mmrn1	UTSW	6	60976439	missense	probably benign	0.15
R5166:Mmrn1	UTSW	6	60976490	missense	probably benign	0.04
R5324:Mmrn1	UTSW	6	60976586	missense	probably damaging	1.00
R5887:Mmrn1	UTSW	6	60987074	missense	probably benign
R5917:Mmrn1	UTSW	6	60973150	critical splice donor site	probably null
R6108:Mmrn1	UTSW	6	60975976	missense	possibly damaging	0.83
R6539:Mmrn1	UTSW	6	60987184	missense	probably benign	0.01
R6996:Mmrn1	UTSW	6	60977383	missense	probably benign	0.04
R7064:Mmrn1	UTSW	6	60988540	nonsense	probably null
R7073:Mmrn1	UTSW	6	60988427	missense	probably damaging	1.00
R7213:Mmrn1	UTSW	6	60944543	start gained	probably benign
R7256:Mmrn1	UTSW	6	60976114	missense	probably damaging	0.98
R7324:Mmrn1	UTSW	6	60944933	nonsense	probably null
R7350:Mmrn1	UTSW	6	60976336	nonsense	probably null
R7388:Mmrn1	UTSW	6	60976252	missense	probably benign	0.43
R7652:Mmrn1	UTSW	6	60977506	missense	probably benign	0.14
R7664:Mmrn1	UTSW	6	60976705	missense	probably benign	0.44
R7810:Mmrn1	UTSW	6	60976325	missense	probably benign	0.18
R7832:Mmrn1	UTSW	6	60987060	splice site	probably null
R7979:Mmrn1	UTSW	6	60975977	missense	probably damaging	0.96
R8071:Mmrn1	UTSW	6	60944524	start gained	probably benign
R8130:Mmrn1	UTSW	6	60960723	missense	probably damaging	1.00
R8277:Mmrn1	UTSW	6	60977236	missense	probably benign	0.19
R8353:Mmrn1	UTSW	6	60988377	missense	probably damaging	1.00
R8453:Mmrn1	UTSW	6	60988377	missense	probably damaging	1.00
R8472:Mmrn1	UTSW	6	60988396	missense	probably damaging	1.00
R8758:Mmrn1	UTSW	6	60987209	missense	possibly damaging	0.54
R8803:Mmrn1	UTSW	6	60988287	missense	probably damaging	1.00
R8879:Mmrn1	UTSW	6	60976529	missense	probably damaging	0.99
R8907:Mmrn1	UTSW	6	60976093	missense	probably damaging	1.00
R8983:Mmrn1	UTSW	6	60976058	missense	probably benign	0.04
R9200:Mmrn1	UTSW	6	60976876	missense	probably damaging	1.00
R9287:Mmrn1	UTSW	6	60975955	missense	probably damaging	1.00
R9387:Mmrn1	UTSW	6	60958192	nonsense	probably null
R9612:Mmrn1	UTSW	6	60976424	missense	probably damaging	0.96
R9674:Mmrn1	UTSW	6	60971088	nonsense	probably null
X0026:Mmrn1	UTSW	6	60976013	missense	probably benign	0.09
Z1176:Mmrn1	UTSW	6	60945034	missense	probably benign	0.37
Z1177:Mmrn1	UTSW	6	60987098	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- ATGCCAATAGTGAAACCACTCATG -3'
(R):5'- CTAGTATAAAATCAGAGGCTTGCG -3'

Sequencing Primer
(F):5'- GTGAAACCACTCATGTTTCAATTGC -3'
(R):5'- ATAGAGAACGCTTCTTCCTCATTTC -3'

Posted On

2015-09-24