Incidental Mutation 'R4590:Pth1r'
ID342754
Institutional Source Beutler Lab
Gene Symbol Pth1r
Ensembl Gene ENSMUSG00000032492
Gene Nameparathyroid hormone 1 receptor
SynonymsPTH-related peptide receptor, PPR, PTH1R, Pthr1, PTH/PTHrP receptor
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4590 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location110722085-110747145 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110722271 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 587 (W587R)
Ref Sequence ENSEMBL: ENSMUSP00000006005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006005] [ENSMUST00000166716] [ENSMUST00000198865]
AlphaFold P41593
Predicted Effect probably benign
Transcript: ENSMUST00000006005
AA Change: W587R

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000006005
Gene: ENSMUSG00000032492
AA Change: W587R

DomainStartEndE-ValueType
HormR 104 179 1.28e-25 SMART
Pfam:7tm_2 184 455 3.5e-89 PFAM
low complexity region 509 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166716
AA Change: W587R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000132064
Gene: ENSMUSG00000032492
AA Change: W587R

DomainStartEndE-ValueType
HormR 104 179 1.28e-25 SMART
Pfam:7tm_2 184 455 9.2e-89 PFAM
low complexity region 509 525 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198865
AA Change: W587R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000143298
Gene: ENSMUSG00000032492
AA Change: W587R

DomainStartEndE-ValueType
HormR 104 179 1.28e-25 SMART
Pfam:7tm_2 184 455 3.5e-89 PFAM
low complexity region 509 525 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the G-protein coupled receptor family 2. This protein is a receptor for parathyroid hormone (PTH) and for parathyroid hormone-like hormone (PTHLH). The activity of this receptor is mediated by G proteins which activate adenylyl cyclase and also a phosphatidylinositol-calcium second messenger system. Defects in this receptor are known to be the cause of Jansen's metaphyseal chondrodysplasia (JMC), chondrodysplasia Blomstrand type (BOCD), as well as enchodromatosis. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous mutant mice die in mid-gestation or shortly after birth depending on genetic background, are small in size, have short limbs, and accelerated differentiation of chondrocytes resulting in accelerated bone mineralization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 T A 18: 36,583,644 D201E probably damaging Het
Ano10 T A 9: 122,257,165 Q398L probably benign Het
Ap3d1 A T 10: 80,719,812 L319* probably null Het
BC003331 A G 1: 150,386,352 probably null Het
Cacna1e T C 1: 154,436,519 M1575V possibly damaging Het
Cep192 T A 18: 67,816,791 Y315* probably null Het
Cndp2 C A 18: 84,669,808 V353F probably damaging Het
Ctsq T A 13: 61,036,214 N298I probably benign Het
Dnah6 A T 6: 73,152,712 C1173S probably damaging Het
Dnah9 T C 11: 66,040,392 M1993V probably damaging Het
Dnhd1 T C 7: 105,714,030 V3933A probably damaging Het
Dnpep C A 1: 75,316,401 V76L probably damaging Het
Dsc3 A C 18: 19,989,695 C57W probably damaging Het
Dtx3 A G 10: 127,192,695 S222P probably damaging Het
Eml5 T C 12: 98,837,341 Y1009C possibly damaging Het
Fam169a A G 13: 97,097,585 I122V probably benign Het
Fgr T A 4: 132,995,053 V211E probably damaging Het
Flvcr1 T C 1: 191,012,146 T402A probably benign Het
Frmd5 C T 2: 121,765,031 probably null Het
Fut2 T C 7: 45,650,946 N134S possibly damaging Het
Gm10110 A T 14: 89,897,546 noncoding transcript Het
Gm7275 A T 16: 48,073,619 noncoding transcript Het
Gm904 T A 13: 50,645,249 C81* probably null Het
Herc1 T A 9: 66,437,664 V1913E probably damaging Het
Hnmt T C 2: 24,019,099 probably null Het
Ift172 T C 5: 31,253,955 E1643G probably damaging Het
Inpp4b T A 8: 81,741,411 M1K probably null Het
Keap1 G T 9: 21,237,609 A34D probably damaging Het
Krt25 T C 11: 99,318,028 probably benign Het
Lama2 A G 10: 26,989,414 V2916A probably benign Het
Ly9 G A 1: 171,593,875 Q603* probably null Het
Mis18bp1 A C 12: 65,158,506 N14K possibly damaging Het
Mmrn1 G T 6: 60,960,813 C265F probably damaging Het
Mrgprb5 C T 7: 48,168,061 E309K probably benign Het
Nrtn T C 17: 56,751,504 T166A probably damaging Het
Olfr150 T C 9: 39,736,850 F12L probably damaging Het
Osbpl7 T A 11: 97,056,272 S266R probably damaging Het
Pcdhb11 T C 18: 37,422,496 I293T probably damaging Het
Pes1 A G 11: 3,977,986 Y546C probably damaging Het
Rasgrf2 A G 13: 92,038,281 Y147H probably damaging Het
Rbbp8 T A 18: 11,732,265 L737* probably null Het
Rcor3 A T 1: 192,125,917 F153L probably damaging Het
Rev3l G A 10: 39,806,933 C349Y probably damaging Het
Rnf115 C T 3: 96,788,573 T225M probably benign Het
Rnf157 A G 11: 116,359,272 V200A probably damaging Het
Scfd2 T C 5: 74,212,256 T653A probably benign Het
Sdccag8 T C 1: 176,948,292 Y590H probably damaging Het
Sema4d T A 13: 51,723,618 K59N probably benign Het
Serpinb7 C A 1: 107,451,833 H323Q probably damaging Het
Setx T A 2: 29,144,809 H435Q probably damaging Het
Sgk3 T C 1: 9,898,795 S466P possibly damaging Het
Sgsm2 T C 11: 74,851,132 M1011V probably damaging Het
Ssc4d G A 5: 135,964,684 P106L probably benign Het
Taf7 T C 18: 37,642,731 Q261R possibly damaging Het
Tbc1d2b T C 9: 90,270,500 K71R possibly damaging Het
Tff3 C T 17: 31,129,534 V15I probably benign Het
Tgfb3 C A 12: 86,077,815 V40L possibly damaging Het
Timm10 T A 2: 84,827,648 D2E possibly damaging Het
Ttc16 T A 2: 32,773,741 N74I probably damaging Het
Ttll1 G A 15: 83,497,345 T241I probably damaging Het
Uba6 T A 5: 86,112,744 D992V probably damaging Het
Vmn1r25 T A 6: 57,978,495 T270S probably benign Het
Vmn2r106 T C 17: 20,277,466 I504V probably damaging Het
Vmn2r87 G T 10: 130,479,145 H191N possibly damaging Het
Vnn1 C A 10: 23,899,405 F184L possibly damaging Het
Vtn A T 11: 78,502,206 I466F probably damaging Het
Zfp352 A C 4: 90,224,535 D304A probably damaging Het
Other mutations in Pth1r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Pth1r APN 9 110727130 missense probably damaging 0.99
IGL01682:Pth1r APN 9 110723706 splice site probably null
IGL02004:Pth1r APN 9 110742308 intron probably benign
IGL02169:Pth1r APN 9 110724435 missense probably damaging 1.00
IGL02548:Pth1r APN 9 110727680 missense probably damaging 1.00
IGL03201:Pth1r APN 9 110722580 missense probably damaging 1.00
R0070:Pth1r UTSW 9 110727550 splice site probably null
R0881:Pth1r UTSW 9 110731573 missense probably damaging 1.00
R1022:Pth1r UTSW 9 110729621 missense probably benign 0.01
R1022:Pth1r UTSW 9 110742227 missense probably damaging 0.96
R1024:Pth1r UTSW 9 110729621 missense probably benign 0.01
R1024:Pth1r UTSW 9 110742227 missense probably damaging 0.96
R2071:Pth1r UTSW 9 110727013 missense probably benign 0.34
R2197:Pth1r UTSW 9 110726990 unclassified probably benign
R2206:Pth1r UTSW 9 110723587 missense probably damaging 1.00
R4184:Pth1r UTSW 9 110742232 start codon destroyed probably null
R4638:Pth1r UTSW 9 110727073 missense possibly damaging 0.60
R4693:Pth1r UTSW 9 110731624 missense probably damaging 1.00
R5457:Pth1r UTSW 9 110726454 missense possibly damaging 0.88
R6235:Pth1r UTSW 9 110722316 missense possibly damaging 0.64
R6682:Pth1r UTSW 9 110727251 splice site probably null
R6683:Pth1r UTSW 9 110727251 splice site probably null
R6914:Pth1r UTSW 9 110728016 splice site probably null
R6942:Pth1r UTSW 9 110728016 splice site probably null
R7164:Pth1r UTSW 9 110723747 missense possibly damaging 0.66
R7638:Pth1r UTSW 9 110722393 missense probably benign
R7883:Pth1r UTSW 9 110731558 missense probably benign 0.02
R8966:Pth1r UTSW 9 110725161 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TTGAGCACAACACAGGAAGC -3'
(R):5'- ACGAGTGTGACCAATGTGG -3'

Sequencing Primer
(F):5'- GGAAGCCACACACAGCTC -3'
(R):5'- TGCAGGACTCAGCCTTCC -3'
Posted On2015-09-24