Incidental Mutation 'R4590:Vnn1'
ID342756
Institutional Source Beutler Lab
Gene Symbol Vnn1
Ensembl Gene ENSMUSG00000037440
Gene Namevanin 1
SynonymsV-1, pantetheinase
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R4590 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location23894688-23905343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 23899405 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 184 (F184L)
Ref Sequence ENSEMBL: ENSMUSP00000040599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041416]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041416
AA Change: F184L

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000040599
Gene: ENSMUSG00000037440
AA Change: F184L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:CN_hydrolase 52 279 2.5e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219254
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the vanin family of proteins, which share extensive sequence similarity with each other, and also with biotinidase. The family includes secreted and membrane-associated proteins, a few of which have been reported to participate in hematopoietic cell trafficking. No biotinidase activity has been demonstrated for any of the vanin proteins, however, they possess pantetheinase activity, which may play a role in oxidative-stress response. This protein, like its mouse homolog, is likely a GPI-anchored cell surface molecule. The mouse protein is expressed by the perivascular thymic stromal cells and regulates migration of T-cell progenitors to the thymus. This gene lies in close proximity to, and in the same transcriptional orientation as, two other vanin genes on chromosome 6q23-q24. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for disruptions of this gene develop normally and so no abnormalities in the maturation of lymphoid organs. However, membrane bound pantetheinase is absent in livers and kidneys resuulting in an absence of cysteamine in these organs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 T A 18: 36,583,644 D201E probably damaging Het
Ano10 T A 9: 122,257,165 Q398L probably benign Het
Ap3d1 A T 10: 80,719,812 L319* probably null Het
BC003331 A G 1: 150,386,352 probably null Het
Cacna1e T C 1: 154,436,519 M1575V possibly damaging Het
Cep192 T A 18: 67,816,791 Y315* probably null Het
Cndp2 C A 18: 84,669,808 V353F probably damaging Het
Ctsq T A 13: 61,036,214 N298I probably benign Het
Dnah6 A T 6: 73,152,712 C1173S probably damaging Het
Dnah9 T C 11: 66,040,392 M1993V probably damaging Het
Dnhd1 T C 7: 105,714,030 V3933A probably damaging Het
Dnpep C A 1: 75,316,401 V76L probably damaging Het
Dsc3 A C 18: 19,989,695 C57W probably damaging Het
Dtx3 A G 10: 127,192,695 S222P probably damaging Het
Eml5 T C 12: 98,837,341 Y1009C possibly damaging Het
Fam169a A G 13: 97,097,585 I122V probably benign Het
Fgr T A 4: 132,995,053 V211E probably damaging Het
Flvcr1 T C 1: 191,012,146 T402A probably benign Het
Frmd5 C T 2: 121,765,031 probably null Het
Fut2 T C 7: 45,650,946 N134S possibly damaging Het
Gm10110 A T 14: 89,897,546 noncoding transcript Het
Gm7275 A T 16: 48,073,619 noncoding transcript Het
Gm904 T A 13: 50,645,249 C81* probably null Het
Herc1 T A 9: 66,437,664 V1913E probably damaging Het
Hnmt T C 2: 24,019,099 probably null Het
Ift172 T C 5: 31,253,955 E1643G probably damaging Het
Inpp4b T A 8: 81,741,411 M1K probably null Het
Keap1 G T 9: 21,237,609 A34D probably damaging Het
Krt25 T C 11: 99,318,028 probably benign Het
Lama2 A G 10: 26,989,414 V2916A probably benign Het
Ly9 G A 1: 171,593,875 Q603* probably null Het
Mis18bp1 A C 12: 65,158,506 N14K possibly damaging Het
Mmrn1 G T 6: 60,960,813 C265F probably damaging Het
Mrgprb5 C T 7: 48,168,061 E309K probably benign Het
Nrtn T C 17: 56,751,504 T166A probably damaging Het
Olfr150 T C 9: 39,736,850 F12L probably damaging Het
Osbpl7 T A 11: 97,056,272 S266R probably damaging Het
Pcdhb11 T C 18: 37,422,496 I293T probably damaging Het
Pes1 A G 11: 3,977,986 Y546C probably damaging Het
Pth1r A T 9: 110,722,271 W587R probably benign Het
Rasgrf2 A G 13: 92,038,281 Y147H probably damaging Het
Rbbp8 T A 18: 11,732,265 L737* probably null Het
Rcor3 A T 1: 192,125,917 F153L probably damaging Het
Rev3l G A 10: 39,806,933 C349Y probably damaging Het
Rnf115 C T 3: 96,788,573 T225M probably benign Het
Rnf157 A G 11: 116,359,272 V200A probably damaging Het
Scfd2 T C 5: 74,212,256 T653A probably benign Het
Sdccag8 T C 1: 176,948,292 Y590H probably damaging Het
Sema4d T A 13: 51,723,618 K59N probably benign Het
Serpinb7 C A 1: 107,451,833 H323Q probably damaging Het
Setx T A 2: 29,144,809 H435Q probably damaging Het
Sgk3 T C 1: 9,898,795 S466P possibly damaging Het
Sgsm2 T C 11: 74,851,132 M1011V probably damaging Het
Ssc4d G A 5: 135,964,684 P106L probably benign Het
Taf7 T C 18: 37,642,731 Q261R possibly damaging Het
Tbc1d2b T C 9: 90,270,500 K71R possibly damaging Het
Tff3 C T 17: 31,129,534 V15I probably benign Het
Tgfb3 C A 12: 86,077,815 V40L possibly damaging Het
Timm10 T A 2: 84,827,648 D2E possibly damaging Het
Ttc16 T A 2: 32,773,741 N74I probably damaging Het
Ttll1 G A 15: 83,497,345 T241I probably damaging Het
Uba6 T A 5: 86,112,744 D992V probably damaging Het
Vmn1r25 T A 6: 57,978,495 T270S probably benign Het
Vmn2r106 T C 17: 20,277,466 I504V probably damaging Het
Vmn2r87 G T 10: 130,479,145 H191N possibly damaging Het
Vtn A T 11: 78,502,206 I466F probably damaging Het
Zfp352 A C 4: 90,224,535 D304A probably damaging Het
Other mutations in Vnn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Vnn1 APN 10 23900779 missense possibly damaging 0.51
IGL01299:Vnn1 APN 10 23895051 missense probably damaging 1.00
IGL01353:Vnn1 APN 10 23900840 missense probably damaging 1.00
IGL01774:Vnn1 APN 10 23900710 missense probably benign 0.26
IGL01970:Vnn1 APN 10 23897402 missense probably benign 0.06
IGL01985:Vnn1 APN 10 23900744 missense probably benign 0.00
IGL02019:Vnn1 APN 10 23903551 missense possibly damaging 0.69
IGL02198:Vnn1 APN 10 23903425 missense probably benign 0.00
IGL02349:Vnn1 APN 10 23898503 missense possibly damaging 0.91
IGL02738:Vnn1 APN 10 23904622 missense probably benign 0.00
IGL03058:Vnn1 APN 10 23904544 missense probably benign 0.06
R0008:Vnn1 UTSW 10 23898602 critical splice donor site probably null
R0030:Vnn1 UTSW 10 23900846 missense probably benign 0.08
R0508:Vnn1 UTSW 10 23895012 missense probably benign 0.01
R0781:Vnn1 UTSW 10 23899601 missense possibly damaging 0.46
R1110:Vnn1 UTSW 10 23899601 missense possibly damaging 0.46
R1757:Vnn1 UTSW 10 23900828 missense possibly damaging 0.49
R1757:Vnn1 UTSW 10 23900829 missense probably benign 0.00
R1778:Vnn1 UTSW 10 23899517 missense possibly damaging 0.67
R2011:Vnn1 UTSW 10 23894971 nonsense probably null
R2055:Vnn1 UTSW 10 23900577 splice site probably benign
R2158:Vnn1 UTSW 10 23900755 nonsense probably null
R2186:Vnn1 UTSW 10 23897401 missense probably benign 0.29
R4277:Vnn1 UTSW 10 23898512 missense possibly damaging 0.89
R4279:Vnn1 UTSW 10 23898512 missense possibly damaging 0.89
R4473:Vnn1 UTSW 10 23894891 missense probably benign
R4708:Vnn1 UTSW 10 23897352 missense probably benign 0.01
R4794:Vnn1 UTSW 10 23900704 missense probably benign 0.01
R5266:Vnn1 UTSW 10 23903405 missense probably damaging 1.00
R5495:Vnn1 UTSW 10 23898564 missense probably damaging 0.98
R6064:Vnn1 UTSW 10 23894909 missense probably benign 0.05
R7081:Vnn1 UTSW 10 23895005 missense possibly damaging 0.66
R7088:Vnn1 UTSW 10 23900747 missense probably benign 0.00
R7221:Vnn1 UTSW 10 23895054 missense probably benign 0.07
R7334:Vnn1 UTSW 10 23900760 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACCGTCTGTACTGAGAAGGGAG -3'
(R):5'- TTCAATGGCTGCCAAATGAGG -3'

Sequencing Primer
(F):5'- TACTGAGAAGGGAGTCATTGGCTC -3'
(R):5'- CCAAATGAGGAAGGACGTCCATC -3'
Posted On2015-09-24