Incidental Mutation 'R4590:Pes1'
ID342762
Institutional Source Beutler Lab
Gene Symbol Pes1
Ensembl Gene ENSMUSG00000020430
Gene Namepescadillo ribosomal biogenesis factor 1
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4590 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location3963975-3980004 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3977986 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 546 (Y546C)
Ref Sequence ENSEMBL: ENSMUSP00000105612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020705] [ENSMUST00000042344] [ENSMUST00000109985]
Predicted Effect probably damaging
Transcript: ENSMUST00000020705
AA Change: Y542C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020705
Gene: ENSMUSG00000020430
AA Change: Y542C

DomainStartEndE-ValueType
Pfam:Pescadillo_N 6 286 5.1e-135 PFAM
BRCT 323 404 4.81e-7 SMART
coiled coil region 469 542 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000042344
SMART Domains Protein: ENSMUSP00000048953
Gene: ENSMUSG00000034493

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
low complexity region 84 93 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109985
AA Change: Y546C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105612
Gene: ENSMUSG00000020430
AA Change: Y546C

DomainStartEndE-ValueType
Pfam:Pescadillo_N 7 284 1.1e-130 PFAM
BRCT 327 408 4.81e-7 SMART
coiled coil region 473 546 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137544
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that contains a breast cancer associated gene 1 (BRCA1) C-terminal interaction domain. The encoded protein interacts with BOP1 and WDR12 to form the PeBoW complex, which plays a critical role in cell proliferation via pre-rRNA processing and 60S ribosomal subunit maturation. Expression of this gene may play an important role in breast cancer proliferation and tumorigenicity. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Pseudogenes of this gene are located on the long arm of chromosome 4 and the short arm of chromosome 9. [provided by RefSeq, Aug 2011]
PHENOTYPE: Targeted disuption of the mouse gene results in embryonic arrest at morula stages of development, as well as failure of nucleologenesis and disruption of ribosome biogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 T A 18: 36,583,644 D201E probably damaging Het
Ano10 T A 9: 122,257,165 Q398L probably benign Het
Ap3d1 A T 10: 80,719,812 L319* probably null Het
BC003331 A G 1: 150,386,352 probably null Het
Cacna1e T C 1: 154,436,519 M1575V possibly damaging Het
Cep192 T A 18: 67,816,791 Y315* probably null Het
Cndp2 C A 18: 84,669,808 V353F probably damaging Het
Ctsq T A 13: 61,036,214 N298I probably benign Het
Dnah6 A T 6: 73,152,712 C1173S probably damaging Het
Dnah9 T C 11: 66,040,392 M1993V probably damaging Het
Dnhd1 T C 7: 105,714,030 V3933A probably damaging Het
Dnpep C A 1: 75,316,401 V76L probably damaging Het
Dsc3 A C 18: 19,989,695 C57W probably damaging Het
Dtx3 A G 10: 127,192,695 S222P probably damaging Het
Eml5 T C 12: 98,837,341 Y1009C possibly damaging Het
Fam169a A G 13: 97,097,585 I122V probably benign Het
Fgr T A 4: 132,995,053 V211E probably damaging Het
Flvcr1 T C 1: 191,012,146 T402A probably benign Het
Frmd5 C T 2: 121,765,031 probably null Het
Fut2 T C 7: 45,650,946 N134S possibly damaging Het
Gm10110 A T 14: 89,897,546 noncoding transcript Het
Gm7275 A T 16: 48,073,619 noncoding transcript Het
Gm904 T A 13: 50,645,249 C81* probably null Het
Herc1 T A 9: 66,437,664 V1913E probably damaging Het
Hnmt T C 2: 24,019,099 probably null Het
Ift172 T C 5: 31,253,955 E1643G probably damaging Het
Inpp4b T A 8: 81,741,411 M1K probably null Het
Keap1 G T 9: 21,237,609 A34D probably damaging Het
Krt25 T C 11: 99,318,028 probably benign Het
Lama2 A G 10: 26,989,414 V2916A probably benign Het
Ly9 G A 1: 171,593,875 Q603* probably null Het
Mis18bp1 A C 12: 65,158,506 N14K possibly damaging Het
Mmrn1 G T 6: 60,960,813 C265F probably damaging Het
Mrgprb5 C T 7: 48,168,061 E309K probably benign Het
Nrtn T C 17: 56,751,504 T166A probably damaging Het
Olfr150 T C 9: 39,736,850 F12L probably damaging Het
Osbpl7 T A 11: 97,056,272 S266R probably damaging Het
Pcdhb11 T C 18: 37,422,496 I293T probably damaging Het
Pth1r A T 9: 110,722,271 W587R probably benign Het
Rasgrf2 A G 13: 92,038,281 Y147H probably damaging Het
Rbbp8 T A 18: 11,732,265 L737* probably null Het
Rcor3 A T 1: 192,125,917 F153L probably damaging Het
Rev3l G A 10: 39,806,933 C349Y probably damaging Het
Rnf115 C T 3: 96,788,573 T225M probably benign Het
Rnf157 A G 11: 116,359,272 V200A probably damaging Het
Scfd2 T C 5: 74,212,256 T653A probably benign Het
Sdccag8 T C 1: 176,948,292 Y590H probably damaging Het
Sema4d T A 13: 51,723,618 K59N probably benign Het
Serpinb7 C A 1: 107,451,833 H323Q probably damaging Het
Setx T A 2: 29,144,809 H435Q probably damaging Het
Sgk3 T C 1: 9,898,795 S466P possibly damaging Het
Sgsm2 T C 11: 74,851,132 M1011V probably damaging Het
Ssc4d G A 5: 135,964,684 P106L probably benign Het
Taf7 T C 18: 37,642,731 Q261R possibly damaging Het
Tbc1d2b T C 9: 90,270,500 K71R possibly damaging Het
Tff3 C T 17: 31,129,534 V15I probably benign Het
Tgfb3 C A 12: 86,077,815 V40L possibly damaging Het
Timm10 T A 2: 84,827,648 D2E possibly damaging Het
Ttc16 T A 2: 32,773,741 N74I probably damaging Het
Ttll1 G A 15: 83,497,345 T241I probably damaging Het
Uba6 T A 5: 86,112,744 D992V probably damaging Het
Vmn1r25 T A 6: 57,978,495 T270S probably benign Het
Vmn2r106 T C 17: 20,277,466 I504V probably damaging Het
Vmn2r87 G T 10: 130,479,145 H191N possibly damaging Het
Vnn1 C A 10: 23,899,405 F184L possibly damaging Het
Vtn A T 11: 78,502,206 I466F probably damaging Het
Zfp352 A C 4: 90,224,535 D304A probably damaging Het
Other mutations in Pes1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Pes1 APN 11 3976803 missense probably damaging 1.00
IGL01448:Pes1 APN 11 3977979 missense possibly damaging 0.89
H8441:Pes1 UTSW 11 3977636 small deletion probably benign
R0634:Pes1 UTSW 11 3977794 splice site probably benign
R0634:Pes1 UTSW 11 3977795 splice site probably benign
R0883:Pes1 UTSW 11 3975557 missense probably damaging 1.00
R0980:Pes1 UTSW 11 3977636 small deletion probably benign
R1435:Pes1 UTSW 11 3976075 missense probably benign 0.00
R1557:Pes1 UTSW 11 3976824 missense probably damaging 1.00
R1694:Pes1 UTSW 11 3977719 small deletion probably benign
R1885:Pes1 UTSW 11 3969482 missense probably damaging 1.00
R1929:Pes1 UTSW 11 3969524 missense probably damaging 1.00
R2270:Pes1 UTSW 11 3969524 missense probably damaging 1.00
R2272:Pes1 UTSW 11 3969524 missense probably damaging 1.00
R2362:Pes1 UTSW 11 3977123 missense probably damaging 1.00
R2869:Pes1 UTSW 11 3976834 missense probably benign 0.05
R2869:Pes1 UTSW 11 3976834 missense probably benign 0.05
R2870:Pes1 UTSW 11 3976834 missense probably benign 0.05
R2870:Pes1 UTSW 11 3976834 missense probably benign 0.05
R2871:Pes1 UTSW 11 3976834 missense probably benign 0.05
R2871:Pes1 UTSW 11 3976834 missense probably benign 0.05
R2873:Pes1 UTSW 11 3976834 missense probably benign 0.05
R3024:Pes1 UTSW 11 3977719 small deletion probably benign
R3039:Pes1 UTSW 11 3975547 missense probably damaging 1.00
R3195:Pes1 UTSW 11 3975736 splice site probably benign
R3773:Pes1 UTSW 11 3975548 missense probably damaging 1.00
R4739:Pes1 UTSW 11 3964058 missense probably damaging 1.00
R5396:Pes1 UTSW 11 3977719 small deletion probably benign
R6016:Pes1 UTSW 11 3978004 missense possibly damaging 0.68
R6351:Pes1 UTSW 11 3978865 missense probably benign
R6921:Pes1 UTSW 11 3973330 missense probably damaging 0.98
R7315:Pes1 UTSW 11 3976085 missense probably benign 0.00
R8178:Pes1 UTSW 11 3977718 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGGGAAGCAGCCTGGTTAG -3'
(R):5'- TGGTGGAGACTGTCTAGCATAAGAC -3'

Sequencing Primer
(F):5'- CACTGTGAAGCTGGAAGA -3'
(R):5'- AAGACCTAGGTTTCTATTCCCAGG -3'
Posted On2015-09-24