Incidental Mutation 'R4590:Sgsm2'
ID342765
Institutional Source Beutler Lab
Gene Symbol Sgsm2
Ensembl Gene ENSMUSG00000038351
Gene Namesmall G protein signaling modulator 2
SynonymsD630003G22Rik, Rutbc1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #R4590 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location74849261-74897060 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74851132 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 1011 (M1011V)
Ref Sequence ENSEMBL: ENSMUSP00000080489 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057631] [ENSMUST00000081799]
Predicted Effect probably damaging
Transcript: ENSMUST00000057631
AA Change: M966V

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050496
Gene: ENSMUSG00000038351
AA Change: M966V

DomainStartEndE-ValueType
RUN 128 188 4.3e-18 SMART
low complexity region 453 476 N/A INTRINSIC
TBC 563 965 3.57e-34 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000081799
AA Change: M1011V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080489
Gene: ENSMUSG00000038351
AA Change: M1011V

DomainStartEndE-ValueType
RUN 128 188 4.3e-18 SMART
low complexity region 446 453 N/A INTRINSIC
low complexity region 498 521 N/A INTRINSIC
TBC 608 1010 3.57e-34 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase activator with activity towards RAB32 and RAB33B, which are regulators of membrane trafficking. The encoded protein inactivates RAB32 and can bind RAB9A-GTP, a protein required for RAB32 activation. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 T A 18: 36,583,644 D201E probably damaging Het
Ano10 T A 9: 122,257,165 Q398L probably benign Het
Ap3d1 A T 10: 80,719,812 L319* probably null Het
BC003331 A G 1: 150,386,352 probably null Het
Cacna1e T C 1: 154,436,519 M1575V possibly damaging Het
Cep192 T A 18: 67,816,791 Y315* probably null Het
Cndp2 C A 18: 84,669,808 V353F probably damaging Het
Ctsq T A 13: 61,036,214 N298I probably benign Het
Dnah6 A T 6: 73,152,712 C1173S probably damaging Het
Dnah9 T C 11: 66,040,392 M1993V probably damaging Het
Dnhd1 T C 7: 105,714,030 V3933A probably damaging Het
Dnpep C A 1: 75,316,401 V76L probably damaging Het
Dsc3 A C 18: 19,989,695 C57W probably damaging Het
Dtx3 A G 10: 127,192,695 S222P probably damaging Het
Eml5 T C 12: 98,837,341 Y1009C possibly damaging Het
Fam169a A G 13: 97,097,585 I122V probably benign Het
Fgr T A 4: 132,995,053 V211E probably damaging Het
Flvcr1 T C 1: 191,012,146 T402A probably benign Het
Frmd5 C T 2: 121,765,031 probably null Het
Fut2 T C 7: 45,650,946 N134S possibly damaging Het
Gm10110 A T 14: 89,897,546 noncoding transcript Het
Gm7275 A T 16: 48,073,619 noncoding transcript Het
Gm904 T A 13: 50,645,249 C81* probably null Het
Herc1 T A 9: 66,437,664 V1913E probably damaging Het
Hnmt T C 2: 24,019,099 probably null Het
Ift172 T C 5: 31,253,955 E1643G probably damaging Het
Inpp4b T A 8: 81,741,411 M1K probably null Het
Keap1 G T 9: 21,237,609 A34D probably damaging Het
Krt25 T C 11: 99,318,028 probably benign Het
Lama2 A G 10: 26,989,414 V2916A probably benign Het
Ly9 G A 1: 171,593,875 Q603* probably null Het
Mis18bp1 A C 12: 65,158,506 N14K possibly damaging Het
Mmrn1 G T 6: 60,960,813 C265F probably damaging Het
Mrgprb5 C T 7: 48,168,061 E309K probably benign Het
Nrtn T C 17: 56,751,504 T166A probably damaging Het
Olfr150 T C 9: 39,736,850 F12L probably damaging Het
Osbpl7 T A 11: 97,056,272 S266R probably damaging Het
Pcdhb11 T C 18: 37,422,496 I293T probably damaging Het
Pes1 A G 11: 3,977,986 Y546C probably damaging Het
Pth1r A T 9: 110,722,271 W587R probably benign Het
Rasgrf2 A G 13: 92,038,281 Y147H probably damaging Het
Rbbp8 T A 18: 11,732,265 L737* probably null Het
Rcor3 A T 1: 192,125,917 F153L probably damaging Het
Rev3l G A 10: 39,806,933 C349Y probably damaging Het
Rnf115 C T 3: 96,788,573 T225M probably benign Het
Rnf157 A G 11: 116,359,272 V200A probably damaging Het
Scfd2 T C 5: 74,212,256 T653A probably benign Het
Sdccag8 T C 1: 176,948,292 Y590H probably damaging Het
Sema4d T A 13: 51,723,618 K59N probably benign Het
Serpinb7 C A 1: 107,451,833 H323Q probably damaging Het
Setx T A 2: 29,144,809 H435Q probably damaging Het
Sgk3 T C 1: 9,898,795 S466P possibly damaging Het
Ssc4d G A 5: 135,964,684 P106L probably benign Het
Taf7 T C 18: 37,642,731 Q261R possibly damaging Het
Tbc1d2b T C 9: 90,270,500 K71R possibly damaging Het
Tff3 C T 17: 31,129,534 V15I probably benign Het
Tgfb3 C A 12: 86,077,815 V40L possibly damaging Het
Timm10 T A 2: 84,827,648 D2E possibly damaging Het
Ttc16 T A 2: 32,773,741 N74I probably damaging Het
Ttll1 G A 15: 83,497,345 T241I probably damaging Het
Uba6 T A 5: 86,112,744 D992V probably damaging Het
Vmn1r25 T A 6: 57,978,495 T270S probably benign Het
Vmn2r106 T C 17: 20,277,466 I504V probably damaging Het
Vmn2r87 G T 10: 130,479,145 H191N possibly damaging Het
Vnn1 C A 10: 23,899,405 F184L possibly damaging Het
Vtn A T 11: 78,502,206 I466F probably damaging Het
Zfp352 A C 4: 90,224,535 D304A probably damaging Het
Other mutations in Sgsm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Sgsm2 APN 11 74853871 missense possibly damaging 0.91
IGL02164:Sgsm2 APN 11 74865416 missense possibly damaging 0.90
IGL02236:Sgsm2 APN 11 74859872 missense probably damaging 1.00
IGL02330:Sgsm2 APN 11 74858667 missense probably benign 0.01
IGL02352:Sgsm2 APN 11 74892074 splice site probably benign
IGL02359:Sgsm2 APN 11 74892074 splice site probably benign
IGL03061:Sgsm2 APN 11 74851136 missense probably damaging 1.00
IGL03180:Sgsm2 APN 11 74868575 critical splice donor site probably null
R0208:Sgsm2 UTSW 11 74868241 missense probably damaging 1.00
R0433:Sgsm2 UTSW 11 74858190 splice site probably null
R0517:Sgsm2 UTSW 11 74867651 missense possibly damaging 0.62
R0755:Sgsm2 UTSW 11 74865497 missense probably damaging 1.00
R1439:Sgsm2 UTSW 11 74869138 missense probably benign 0.34
R1527:Sgsm2 UTSW 11 74853848 nonsense probably null
R1713:Sgsm2 UTSW 11 74896826 missense probably null 0.04
R1962:Sgsm2 UTSW 11 74892028 missense probably damaging 1.00
R2189:Sgsm2 UTSW 11 74853082 missense probably damaging 1.00
R4259:Sgsm2 UTSW 11 74892028 missense probably damaging 1.00
R4261:Sgsm2 UTSW 11 74892028 missense probably damaging 1.00
R4408:Sgsm2 UTSW 11 74851766 missense probably damaging 0.99
R6137:Sgsm2 UTSW 11 74850851 missense probably damaging 1.00
R6162:Sgsm2 UTSW 11 74892021 missense probably damaging 1.00
R6457:Sgsm2 UTSW 11 74865169 missense possibly damaging 0.77
R6681:Sgsm2 UTSW 11 74865378 missense probably damaging 0.99
R6722:Sgsm2 UTSW 11 74865424 missense probably damaging 1.00
R6986:Sgsm2 UTSW 11 74892041 missense probably damaging 1.00
R7205:Sgsm2 UTSW 11 74854493 missense possibly damaging 0.88
R7209:Sgsm2 UTSW 11 74854325 missense probably damaging 0.98
R7655:Sgsm2 UTSW 11 74865497 missense probably damaging 1.00
R7656:Sgsm2 UTSW 11 74865497 missense probably damaging 1.00
R8526:Sgsm2 UTSW 11 74869021 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- ACCTGCTGTGCTCTTGATAC -3'
(R):5'- GGAGCATCTGCAGAGATAGC -3'

Sequencing Primer
(F):5'- GATACCTCCTATGCGAAGTGATC -3'
(R):5'- GATGGATTCCCCCATTCTGGAG -3'
Posted On2015-09-24