Incidental Mutation 'R4590:Krt25'
ID342768
Institutional Source Beutler Lab
Gene Symbol Krt25
Ensembl Gene ENSMUSG00000035831
Gene Namekeratin 25
Synonyms4631426H08Rik, mIRSa1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R4590 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location99315516-99322951 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 99318028 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000048439 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038004] [ENSMUST00000038004]
AlphaFold Q8VCW2
Predicted Effect probably benign
Transcript: ENSMUST00000038004
SMART Domains Protein: ENSMUSP00000048439
Gene: ENSMUSG00000035831

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
low complexity region 35 52 N/A INTRINSIC
Filament 74 389 4.13e-146 SMART
low complexity region 391 403 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000038004
SMART Domains Protein: ENSMUSP00000048439
Gene: ENSMUSG00000035831

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
low complexity region 35 52 N/A INTRINSIC
Filament 74 389 4.13e-146 SMART
low complexity region 391 403 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mutations in this gene have a defect in hair formation resulting in a wavy coat and curly vibrissae. Some alleles may compromise normal growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankhd1 T A 18: 36,583,644 D201E probably damaging Het
Ano10 T A 9: 122,257,165 Q398L probably benign Het
Ap3d1 A T 10: 80,719,812 L319* probably null Het
BC003331 A G 1: 150,386,352 probably null Het
Cacna1e T C 1: 154,436,519 M1575V possibly damaging Het
Cep192 T A 18: 67,816,791 Y315* probably null Het
Cndp2 C A 18: 84,669,808 V353F probably damaging Het
Ctsq T A 13: 61,036,214 N298I probably benign Het
Dnah6 A T 6: 73,152,712 C1173S probably damaging Het
Dnah9 T C 11: 66,040,392 M1993V probably damaging Het
Dnhd1 T C 7: 105,714,030 V3933A probably damaging Het
Dnpep C A 1: 75,316,401 V76L probably damaging Het
Dsc3 A C 18: 19,989,695 C57W probably damaging Het
Dtx3 A G 10: 127,192,695 S222P probably damaging Het
Eml5 T C 12: 98,837,341 Y1009C possibly damaging Het
Fam169a A G 13: 97,097,585 I122V probably benign Het
Fgr T A 4: 132,995,053 V211E probably damaging Het
Flvcr1 T C 1: 191,012,146 T402A probably benign Het
Frmd5 C T 2: 121,765,031 probably null Het
Fut2 T C 7: 45,650,946 N134S possibly damaging Het
Gm10110 A T 14: 89,897,546 noncoding transcript Het
Gm7275 A T 16: 48,073,619 noncoding transcript Het
Gm904 T A 13: 50,645,249 C81* probably null Het
Herc1 T A 9: 66,437,664 V1913E probably damaging Het
Hnmt T C 2: 24,019,099 probably null Het
Ift172 T C 5: 31,253,955 E1643G probably damaging Het
Inpp4b T A 8: 81,741,411 M1K probably null Het
Keap1 G T 9: 21,237,609 A34D probably damaging Het
Lama2 A G 10: 26,989,414 V2916A probably benign Het
Ly9 G A 1: 171,593,875 Q603* probably null Het
Mis18bp1 A C 12: 65,158,506 N14K possibly damaging Het
Mmrn1 G T 6: 60,960,813 C265F probably damaging Het
Mrgprb5 C T 7: 48,168,061 E309K probably benign Het
Nrtn T C 17: 56,751,504 T166A probably damaging Het
Olfr150 T C 9: 39,736,850 F12L probably damaging Het
Osbpl7 T A 11: 97,056,272 S266R probably damaging Het
Pcdhb11 T C 18: 37,422,496 I293T probably damaging Het
Pes1 A G 11: 3,977,986 Y546C probably damaging Het
Pth1r A T 9: 110,722,271 W587R probably benign Het
Rasgrf2 A G 13: 92,038,281 Y147H probably damaging Het
Rbbp8 T A 18: 11,732,265 L737* probably null Het
Rcor3 A T 1: 192,125,917 F153L probably damaging Het
Rev3l G A 10: 39,806,933 C349Y probably damaging Het
Rnf115 C T 3: 96,788,573 T225M probably benign Het
Rnf157 A G 11: 116,359,272 V200A probably damaging Het
Scfd2 T C 5: 74,212,256 T653A probably benign Het
Sdccag8 T C 1: 176,948,292 Y590H probably damaging Het
Sema4d T A 13: 51,723,618 K59N probably benign Het
Serpinb7 C A 1: 107,451,833 H323Q probably damaging Het
Setx T A 2: 29,144,809 H435Q probably damaging Het
Sgk3 T C 1: 9,898,795 S466P possibly damaging Het
Sgsm2 T C 11: 74,851,132 M1011V probably damaging Het
Ssc4d G A 5: 135,964,684 P106L probably benign Het
Taf7 T C 18: 37,642,731 Q261R possibly damaging Het
Tbc1d2b T C 9: 90,270,500 K71R possibly damaging Het
Tff3 C T 17: 31,129,534 V15I probably benign Het
Tgfb3 C A 12: 86,077,815 V40L possibly damaging Het
Timm10 T A 2: 84,827,648 D2E possibly damaging Het
Ttc16 T A 2: 32,773,741 N74I probably damaging Het
Ttll1 G A 15: 83,497,345 T241I probably damaging Het
Uba6 T A 5: 86,112,744 D992V probably damaging Het
Vmn1r25 T A 6: 57,978,495 T270S probably benign Het
Vmn2r106 T C 17: 20,277,466 I504V probably damaging Het
Vmn2r87 G T 10: 130,479,145 H191N possibly damaging Het
Vnn1 C A 10: 23,899,405 F184L possibly damaging Het
Vtn A T 11: 78,502,206 I466F probably damaging Het
Zfp352 A C 4: 90,224,535 D304A probably damaging Het
Other mutations in Krt25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Krt25 APN 11 99318170 missense probably benign 0.28
IGL02415:Krt25 APN 11 99322572 missense probably damaging 1.00
IGL02816:Krt25 APN 11 99318151 missense probably benign 0.10
Plush UTSW 11 99322635 missense probably damaging 1.00
Sinuous UTSW 11 99322630 missense probably damaging 0.99
R0138:Krt25 UTSW 11 99322698 missense probably benign 0.00
R0219:Krt25 UTSW 11 99318059 missense probably benign 0.01
R0932:Krt25 UTSW 11 99321283 missense possibly damaging 0.94
R1733:Krt25 UTSW 11 99316552 nonsense probably null
R1855:Krt25 UTSW 11 99318315 missense probably damaging 1.00
R2120:Krt25 UTSW 11 99321197 missense probably benign 0.01
R2504:Krt25 UTSW 11 99317296 nonsense probably null
R3615:Krt25 UTSW 11 99317298 missense possibly damaging 0.64
R3616:Krt25 UTSW 11 99317298 missense possibly damaging 0.64
R6250:Krt25 UTSW 11 99321163 missense probably damaging 1.00
R6331:Krt25 UTSW 11 99317427 missense probably damaging 1.00
R6927:Krt25 UTSW 11 99317379 missense probably damaging 1.00
R7067:Krt25 UTSW 11 99317383 missense probably benign 0.01
R7289:Krt25 UTSW 11 99321272 missense probably benign 0.15
R7360:Krt25 UTSW 11 99317406 missense probably benign 0.01
R8057:Krt25 UTSW 11 99317343 missense probably benign 0.44
R8090:Krt25 UTSW 11 99316590 critical splice acceptor site probably null
R8933:Krt25 UTSW 11 99321238 missense probably benign 0.31
R8995:Krt25 UTSW 11 99316556 missense probably benign
R9040:Krt25 UTSW 11 99316553 missense probably benign
Z1176:Krt25 UTSW 11 99322822 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GGGAAGCACTCTGAAATGACAC -3'
(R):5'- AAAATCTGCCCCTCTTGGATG -3'

Sequencing Primer
(F):5'- ACCATCTGTAGTGAGATCCAGTGC -3'
(R):5'- GCCCCTCTTGGATGTCATTTAAGAG -3'
Posted On2015-09-24