Mutagenetix > Incidental Mutation

Incidental Mutation 'R4590:Eml5'

342772

Institutional Source

Beutler Lab

Gene Symbol

Eml5

Ensembl Gene

ENSMUSG00000051166

Gene Name

echinoderm microtubule associated protein like 5

Synonyms

C130068M19Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.237) question?

Stock #

R4590 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

98786805-98901484 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 98837341 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 1009 (Y1009C)

Ref Sequence

ENSEMBL: ENSMUSP00000152709 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]

AlphaFold

Q8BQM8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000065716
AA Change: Y970C

PolyPhen 2 Score 0.677 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: Y970C

Domain	Start	End	E-Value	Type
Pfam:HELP	1	49	3.3e-21	PFAM
WD40	50	91	6.42e-1	SMART
WD40	94	136	1.08e-4	SMART
WD40	139	178	1.27e-1	SMART
WD40	184	224	2.75e1	SMART
WD40	225	263	2.65e-4	SMART
Blast:WD40	265	312	2e-22	BLAST
WD40	313	353	4.69e-5	SMART
WD40	356	394	2.2e2	SMART
WD40	397	436	8.59e-1	SMART
WD40	444	479	6.6e1	SMART
WD40	505	546	2.74e2	SMART
WD40	552	592	4.8e-2	SMART
low complexity region	609	632	N/A	INTRINSIC
Pfam:HELP	656	715	1.4e-20	PFAM
WD40	716	757	1.18e-1	SMART
WD40	760	802	2.84e-4	SMART
WD40	805	844	1.91e1	SMART
WD40	853	891	2.64e2	SMART
WD40	892	929	3.45e-3	SMART
WD40	985	1026	4.55e-3	SMART
WD40	1029	1068	6.39e0	SMART
WD40	1071	1111	5.15e-2	SMART
WD40	1180	1221	1.9e2	SMART
WD40	1227	1267	1.38e0	SMART
low complexity region	1280	1297	N/A	INTRINSIC
Pfam:HELP	1335	1410	2.4e-16	PFAM
Blast:WD40	1412	1462	8e-28	BLAST
WD40	1465	1507	1.56e-1	SMART
WD40	1510	1549	2.06e0	SMART
WD40	1558	1597	8.22e1	SMART
WD40	1599	1644	4.26e1	SMART
WD40	1690	1730	2.19e-5	SMART
WD40	1774	1813	5.97e-1	SMART
WD40	1884	1925	2.39e0	SMART
WD40	1931	1971	2.88e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221662

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223282
AA Change: Y1009C

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankhd1	T	A	18: 36,583,644	D201E	probably damaging	Het
Ano10	T	A	9: 122,257,165	Q398L	probably benign	Het
Ap3d1	A	T	10: 80,719,812	L319*	probably null	Het
BC003331	A	G	1: 150,386,352		probably null	Het
Cacna1e	T	C	1: 154,436,519	M1575V	possibly damaging	Het
Cep192	T	A	18: 67,816,791	Y315*	probably null	Het
Cndp2	C	A	18: 84,669,808	V353F	probably damaging	Het
Ctsq	T	A	13: 61,036,214	N298I	probably benign	Het
Dnah6	A	T	6: 73,152,712	C1173S	probably damaging	Het
Dnah9	T	C	11: 66,040,392	M1993V	probably damaging	Het
Dnhd1	T	C	7: 105,714,030	V3933A	probably damaging	Het
Dnpep	C	A	1: 75,316,401	V76L	probably damaging	Het
Dsc3	A	C	18: 19,989,695	C57W	probably damaging	Het
Dtx3	A	G	10: 127,192,695	S222P	probably damaging	Het
Fam169a	A	G	13: 97,097,585	I122V	probably benign	Het
Fgr	T	A	4: 132,995,053	V211E	probably damaging	Het
Flvcr1	T	C	1: 191,012,146	T402A	probably benign	Het
Frmd5	C	T	2: 121,765,031		probably null	Het
Fut2	T	C	7: 45,650,946	N134S	possibly damaging	Het
Gm10110	A	T	14: 89,897,546		noncoding transcript	Het
Gm7275	A	T	16: 48,073,619		noncoding transcript	Het
Gm904	T	A	13: 50,645,249	C81*	probably null	Het
Herc1	T	A	9: 66,437,664	V1913E	probably damaging	Het
Hnmt	T	C	2: 24,019,099		probably null	Het
Ift172	T	C	5: 31,253,955	E1643G	probably damaging	Het
Inpp4b	T	A	8: 81,741,411	M1K	probably null	Het
Keap1	G	T	9: 21,237,609	A34D	probably damaging	Het
Krt25	T	C	11: 99,318,028		probably benign	Het
Lama2	A	G	10: 26,989,414	V2916A	probably benign	Het
Ly9	G	A	1: 171,593,875	Q603*	probably null	Het
Mis18bp1	A	C	12: 65,158,506	N14K	possibly damaging	Het
Mmrn1	G	T	6: 60,960,813	C265F	probably damaging	Het
Mrgprb5	C	T	7: 48,168,061	E309K	probably benign	Het
Nrtn	T	C	17: 56,751,504	T166A	probably damaging	Het
Olfr150	T	C	9: 39,736,850	F12L	probably damaging	Het
Osbpl7	T	A	11: 97,056,272	S266R	probably damaging	Het
Pcdhb11	T	C	18: 37,422,496	I293T	probably damaging	Het
Pes1	A	G	11: 3,977,986	Y546C	probably damaging	Het
Pth1r	A	T	9: 110,722,271	W587R	probably benign	Het
Rasgrf2	A	G	13: 92,038,281	Y147H	probably damaging	Het
Rbbp8	T	A	18: 11,732,265	L737*	probably null	Het
Rcor3	A	T	1: 192,125,917	F153L	probably damaging	Het
Rev3l	G	A	10: 39,806,933	C349Y	probably damaging	Het
Rnf115	C	T	3: 96,788,573	T225M	probably benign	Het
Rnf157	A	G	11: 116,359,272	V200A	probably damaging	Het
Scfd2	T	C	5: 74,212,256	T653A	probably benign	Het
Sdccag8	T	C	1: 176,948,292	Y590H	probably damaging	Het
Sema4d	T	A	13: 51,723,618	K59N	probably benign	Het
Serpinb7	C	A	1: 107,451,833	H323Q	probably damaging	Het
Setx	T	A	2: 29,144,809	H435Q	probably damaging	Het
Sgk3	T	C	1: 9,898,795	S466P	possibly damaging	Het
Sgsm2	T	C	11: 74,851,132	M1011V	probably damaging	Het
Ssc4d	G	A	5: 135,964,684	P106L	probably benign	Het
Taf7	T	C	18: 37,642,731	Q261R	possibly damaging	Het
Tbc1d2b	T	C	9: 90,270,500	K71R	possibly damaging	Het
Tff3	C	T	17: 31,129,534	V15I	probably benign	Het
Tgfb3	C	A	12: 86,077,815	V40L	possibly damaging	Het
Timm10	T	A	2: 84,827,648	D2E	possibly damaging	Het
Ttc16	T	A	2: 32,773,741	N74I	probably damaging	Het
Ttll1	G	A	15: 83,497,345	T241I	probably damaging	Het
Uba6	T	A	5: 86,112,744	D992V	probably damaging	Het
Vmn1r25	T	A	6: 57,978,495	T270S	probably benign	Het
Vmn2r106	T	C	17: 20,277,466	I504V	probably damaging	Het
Vmn2r87	G	T	10: 130,479,145	H191N	possibly damaging	Het
Vnn1	C	A	10: 23,899,405	F184L	possibly damaging	Het
Vtn	A	T	11: 78,502,206	I466F	probably damaging	Het
Zfp352	A	C	4: 90,224,535	D304A	probably damaging	Het

Other mutations in Eml5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Eml5	APN	12	98873209	splice site	probably benign
IGL00473:Eml5	APN	12	98805492	splice site	probably benign
IGL01120:Eml5	APN	12	98844019	missense	probably benign
IGL01308:Eml5	APN	12	98802313	missense	probably damaging	1.00
IGL01790:Eml5	APN	12	98798932	missense	probably damaging	1.00
IGL01973:Eml5	APN	12	98863280	missense	probably benign
IGL02182:Eml5	APN	12	98802322	missense	probably damaging	1.00
IGL02201:Eml5	APN	12	98794424	splice site	probably benign
IGL02375:Eml5	APN	12	98844087	missense	probably damaging	1.00
IGL02397:Eml5	APN	12	98790674	missense	probably benign	0.07
IGL02480:Eml5	APN	12	98876243	missense	probably damaging	1.00
IGL02801:Eml5	APN	12	98817845	missense	possibly damaging	0.88
IGL02876:Eml5	APN	12	98858841	missense	probably damaging	1.00
IGL03104:Eml5	APN	12	98861245	nonsense	probably null
IGL03158:Eml5	APN	12	98827514	splice site	probably benign
IGL03286:Eml5	APN	12	98860503	missense	probably damaging	1.00
IGL03380:Eml5	APN	12	98874647	splice site	probably benign
BB010:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
BB020:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R0573:Eml5	UTSW	12	98824772	splice site	probably null
R0624:Eml5	UTSW	12	98865479	missense	probably damaging	1.00
R0993:Eml5	UTSW	12	98861183	missense	probably benign	0.25
R1073:Eml5	UTSW	12	98830973	missense	probably damaging	1.00
R1183:Eml5	UTSW	12	98792046	missense	probably benign	0.31
R1352:Eml5	UTSW	12	98831003	splice site	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1503:Eml5	UTSW	12	98831174	missense	probably damaging	0.99
R1538:Eml5	UTSW	12	98794276	missense	probably damaging	0.99
R1689:Eml5	UTSW	12	98830935	missense	probably damaging	1.00
R1773:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1775:Eml5	UTSW	12	98852704	splice site	probably null
R1791:Eml5	UTSW	12	98887056	missense	probably benign	0.31
R1856:Eml5	UTSW	12	98810584	missense	probably damaging	1.00
R1919:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1957:Eml5	UTSW	12	98859961	missense	probably damaging	1.00
R1962:Eml5	UTSW	12	98876311	missense	probably damaging	0.99
R2033:Eml5	UTSW	12	98791386	missense	possibly damaging	0.71
R2035:Eml5	UTSW	12	98794266	missense	probably benign	0.33
R2073:Eml5	UTSW	12	98802446	missense	probably damaging	0.99
R2143:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2144:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2158:Eml5	UTSW	12	98843946	splice site	probably benign
R2164:Eml5	UTSW	12	98887097	missense	probably damaging	0.99
R2175:Eml5	UTSW	12	98876223	nonsense	probably null
R2200:Eml5	UTSW	12	98825417	missense	probably damaging	1.00
R2234:Eml5	UTSW	12	98841581	missense	probably damaging	1.00
R2504:Eml5	UTSW	12	98844105	missense	possibly damaging	0.71
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2958:Eml5	UTSW	12	98876178	missense	possibly damaging	0.74
R3013:Eml5	UTSW	12	98880808	splice site	probably null
R3118:Eml5	UTSW	12	98865494	missense	probably damaging	0.97
R3735:Eml5	UTSW	12	98855989	missense	possibly damaging	0.78
R3856:Eml5	UTSW	12	98816024	missense	probably damaging	1.00
R3900:Eml5	UTSW	12	98825523	missense	probably damaging	1.00
R3973:Eml5	UTSW	12	98802465	splice site	probably benign
R3976:Eml5	UTSW	12	98802465	splice site	probably benign
R4105:Eml5	UTSW	12	98841548	splice site	probably null
R4107:Eml5	UTSW	12	98841548	splice site	probably null
R4108:Eml5	UTSW	12	98841548	splice site	probably null
R4109:Eml5	UTSW	12	98841548	splice site	probably null
R4258:Eml5	UTSW	12	98865434	missense	probably benign	0.01
R4381:Eml5	UTSW	12	98815955	missense	possibly damaging	0.93
R4737:Eml5	UTSW	12	98798852	missense	probably damaging	1.00
R4775:Eml5	UTSW	12	98802307	missense	probably benign	0.05
R4850:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5007:Eml5	UTSW	12	98830965	missense	probably damaging	1.00
R5092:Eml5	UTSW	12	98792616	missense	probably damaging	1.00
R5123:Eml5	UTSW	12	98874512	missense	probably damaging	1.00
R5124:Eml5	UTSW	12	98792042	missense	probably damaging	1.00
R5273:Eml5	UTSW	12	98790688	missense	probably damaging	1.00
R5369:Eml5	UTSW	12	98858783	missense	probably damaging	1.00
R5430:Eml5	UTSW	12	98794158	missense	probably damaging	1.00
R5748:Eml5	UTSW	12	98825555	missense	probably damaging	0.99
R5769:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5832:Eml5	UTSW	12	98876188	missense	probably benign
R6113:Eml5	UTSW	12	98824674	nonsense	probably null
R6131:Eml5	UTSW	12	98861251	missense	probably damaging	0.99
R6175:Eml5	UTSW	12	98794456	missense	possibly damaging	0.69
R6184:Eml5	UTSW	12	98863129	missense	possibly damaging	0.53
R6357:Eml5	UTSW	12	98870884	missense	probably damaging	0.98
R6375:Eml5	UTSW	12	98798868
R6528:Eml5	UTSW	12	98824637	missense	probably benign	0.18
R6657:Eml5	UTSW	12	98791405	missense	probably damaging	0.98
R6717:Eml5	UTSW	12	98827506	missense	probably damaging	1.00
R6751:Eml5	UTSW	12	98865400	missense	probably damaging	1.00
R6833:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6834:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6972:Eml5	UTSW	12	98876180	missense	probably benign	0.00
R7091:Eml5	UTSW	12	98802474	missense	probably benign	0.16
R7353:Eml5	UTSW	12	98825424	missense
R7644:Eml5	UTSW	12	98855944	missense	probably benign	0.05
R7694:Eml5	UTSW	12	98792563	missense	probably damaging	0.99
R7842:Eml5	UTSW	12	98794135	missense	probably damaging	1.00
R7933:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R8111:Eml5	UTSW	12	98792514	critical splice donor site	probably null
R8198:Eml5	UTSW	12	98858886	nonsense	probably null
R8482:Eml5	UTSW	12	98876301	missense	probably damaging	1.00
R8732:Eml5	UTSW	12	98815959	missense	probably damaging	0.99
R8956:Eml5	UTSW	12	98852693	missense	possibly damaging	0.69
R8975:Eml5	UTSW	12	98810570	missense	probably damaging	0.99
R9131:Eml5	UTSW	12	98858840	missense	probably damaging	1.00
R9258:Eml5	UTSW	12	98844117	missense	possibly damaging	0.77
R9261:Eml5	UTSW	12	98856028	missense	probably damaging	0.99
R9276:Eml5	UTSW	12	98798801	missense	probably damaging	0.99
R9301:Eml5	UTSW	12	98882033	nonsense	probably null
R9368:Eml5	UTSW	12	98796578	missense	probably benign	0.31
R9392:Eml5	UTSW	12	98900940	missense	probably damaging	1.00
R9393:Eml5	UTSW	12	98876174	missense	probably benign	0.35
R9449:Eml5	UTSW	12	98861295	missense	probably damaging	1.00
R9570:Eml5	UTSW	12	98815984	missense	probably benign	0.15
T0722:Eml5	UTSW	12	98841582	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- TGTCACAAGTTCAGTCCAAGG -3'
(R):5'- CCTTGTCAAGGCTTTACTGAAC -3'

Sequencing Primer
(F):5'- CCTTTGCAAGAGACATTCTATGGC -3'
(R):5'- CAAGGCTTTACTGAACTTAGAGGTCC -3'

Posted On

2015-09-24