Mutagenetix > Incidental Mutations

Incidental Mutation 'R4590:Rasgrf2'

342776

Institutional Source

Beutler Lab

Gene Symbol

Rasgrf2

Ensembl Gene

ENSMUSG00000021708

Gene Name

RAS protein-specific guanine nucleotide-releasing factor 2

Synonyms

Grf2, 6330417G04Rik

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.318) question?

Stock #

R4590 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

91880400-92131656 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 92038281 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 147 (Y147H)

Ref Sequence

ENSEMBL: ENSMUSP00000116203 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099326] [ENSMUST00000146492] [ENSMUST00000216219]

AlphaFold

P70392

Predicted Effect

probably damaging
Transcript: ENSMUST00000099326
AA Change: Y147H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708
AA Change: Y147H

Domain	Start	End	E-Value	Type
PH	23	135	1.29e-16	SMART
IQ	204	226	1.3e0	SMART
RhoGEF	247	428	2.2e-51	SMART
RasGEFN	633	775	9.35e-15	SMART
RasGEFN	786	923	6.04e-9	SMART
RasGEF	949	1186	2.97e-112	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000146492
AA Change: Y147H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000116203
Gene: ENSMUSG00000021708
AA Change: Y147H

Domain	Start	End	E-Value	Type
PH	23	135	1.29e-16	SMART
IQ	204	226	1.3e0	SMART
Pfam:RhoGEF	247	387	1.2e-24	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000216219
AA Change: Y147H

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ankhd1	T	A	18: 36,583,644	D201E	probably damaging	Het
Ano10	T	A	9: 122,257,165	Q398L	probably benign	Het
Ap3d1	A	T	10: 80,719,812	L319*	probably null	Het
BC003331	A	G	1: 150,386,352		probably null	Het
Cacna1e	T	C	1: 154,436,519	M1575V	possibly damaging	Het
Cep192	T	A	18: 67,816,791	Y315*	probably null	Het
Cndp2	C	A	18: 84,669,808	V353F	probably damaging	Het
Ctsq	T	A	13: 61,036,214	N298I	probably benign	Het
Dnah6	A	T	6: 73,152,712	C1173S	probably damaging	Het
Dnah9	T	C	11: 66,040,392	M1993V	probably damaging	Het
Dnhd1	T	C	7: 105,714,030	V3933A	probably damaging	Het
Dnpep	C	A	1: 75,316,401	V76L	probably damaging	Het
Dsc3	A	C	18: 19,989,695	C57W	probably damaging	Het
Dtx3	A	G	10: 127,192,695	S222P	probably damaging	Het
Eml5	T	C	12: 98,837,341	Y1009C	possibly damaging	Het
Fam169a	A	G	13: 97,097,585	I122V	probably benign	Het
Fgr	T	A	4: 132,995,053	V211E	probably damaging	Het
Flvcr1	T	C	1: 191,012,146	T402A	probably benign	Het
Frmd5	C	T	2: 121,765,031		probably null	Het
Fut2	T	C	7: 45,650,946	N134S	possibly damaging	Het
Gm10110	A	T	14: 89,897,546		noncoding transcript	Het
Gm7275	A	T	16: 48,073,619		noncoding transcript	Het
Gm904	T	A	13: 50,645,249	C81*	probably null	Het
Herc1	T	A	9: 66,437,664	V1913E	probably damaging	Het
Hnmt	T	C	2: 24,019,099		probably null	Het
Ift172	T	C	5: 31,253,955	E1643G	probably damaging	Het
Inpp4b	T	A	8: 81,741,411	M1K	probably null	Het
Keap1	G	T	9: 21,237,609	A34D	probably damaging	Het
Krt25	T	C	11: 99,318,028		probably benign	Het
Lama2	A	G	10: 26,989,414	V2916A	probably benign	Het
Ly9	G	A	1: 171,593,875	Q603*	probably null	Het
Mis18bp1	A	C	12: 65,158,506	N14K	possibly damaging	Het
Mmrn1	G	T	6: 60,960,813	C265F	probably damaging	Het
Mrgprb5	C	T	7: 48,168,061	E309K	probably benign	Het
Nrtn	T	C	17: 56,751,504	T166A	probably damaging	Het
Olfr150	T	C	9: 39,736,850	F12L	probably damaging	Het
Osbpl7	T	A	11: 97,056,272	S266R	probably damaging	Het
Pcdhb11	T	C	18: 37,422,496	I293T	probably damaging	Het
Pes1	A	G	11: 3,977,986	Y546C	probably damaging	Het
Pth1r	A	T	9: 110,722,271	W587R	probably benign	Het
Rbbp8	T	A	18: 11,732,265	L737*	probably null	Het
Rcor3	A	T	1: 192,125,917	F153L	probably damaging	Het
Rev3l	G	A	10: 39,806,933	C349Y	probably damaging	Het
Rnf115	C	T	3: 96,788,573	T225M	probably benign	Het
Rnf157	A	G	11: 116,359,272	V200A	probably damaging	Het
Scfd2	T	C	5: 74,212,256	T653A	probably benign	Het
Sdccag8	T	C	1: 176,948,292	Y590H	probably damaging	Het
Sema4d	T	A	13: 51,723,618	K59N	probably benign	Het
Serpinb7	C	A	1: 107,451,833	H323Q	probably damaging	Het
Setx	T	A	2: 29,144,809	H435Q	probably damaging	Het
Sgk3	T	C	1: 9,898,795	S466P	possibly damaging	Het
Sgsm2	T	C	11: 74,851,132	M1011V	probably damaging	Het
Ssc4d	G	A	5: 135,964,684	P106L	probably benign	Het
Taf7	T	C	18: 37,642,731	Q261R	possibly damaging	Het
Tbc1d2b	T	C	9: 90,270,500	K71R	possibly damaging	Het
Tff3	C	T	17: 31,129,534	V15I	probably benign	Het
Tgfb3	C	A	12: 86,077,815	V40L	possibly damaging	Het
Timm10	T	A	2: 84,827,648	D2E	possibly damaging	Het
Ttc16	T	A	2: 32,773,741	N74I	probably damaging	Het
Ttll1	G	A	15: 83,497,345	T241I	probably damaging	Het
Uba6	T	A	5: 86,112,744	D992V	probably damaging	Het
Vmn1r25	T	A	6: 57,978,495	T270S	probably benign	Het
Vmn2r106	T	C	17: 20,277,466	I504V	probably damaging	Het
Vmn2r87	G	T	10: 130,479,145	H191N	possibly damaging	Het
Vnn1	C	A	10: 23,899,405	F184L	possibly damaging	Het
Vtn	A	T	11: 78,502,206	I466F	probably damaging	Het
Zfp352	A	C	4: 90,224,535	D304A	probably damaging	Het

Other mutations in Rasgrf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01308:Rasgrf2	APN	13	92022917	splice site	probably benign
IGL01358:Rasgrf2	APN	13	91982630	missense	probably benign	0.23
IGL01666:Rasgrf2	APN	13	92038210	missense	probably damaging	1.00
IGL01930:Rasgrf2	APN	13	91982738	missense	probably damaging	0.98
IGL02230:Rasgrf2	APN	13	91988026	missense	probably damaging	1.00
IGL02630:Rasgrf2	APN	13	92131392	missense	probably damaging	1.00
IGL02690:Rasgrf2	APN	13	92030765	missense	probably damaging	1.00
IGL02943:Rasgrf2	APN	13	91983633	missense	probably damaging	1.00
IGL03067:Rasgrf2	APN	13	92022905	missense	probably damaging	0.97
IGL03342:Rasgrf2	APN	13	91987979	missense	probably damaging	1.00
IGL03405:Rasgrf2	APN	13	91896051	missense	probably damaging	1.00
R0620:Rasgrf2	UTSW	13	91919817	splice site	probably benign
R0632:Rasgrf2	UTSW	13	91972274	missense	probably benign	0.00
R0894:Rasgrf2	UTSW	13	91982771	missense	probably damaging	1.00
R1354:Rasgrf2	UTSW	13	92028666	missense	probably damaging	1.00
R1400:Rasgrf2	UTSW	13	91887689	missense	probably damaging	1.00
R1437:Rasgrf2	UTSW	13	92030888	missense	probably damaging	1.00
R1443:Rasgrf2	UTSW	13	91983676	missense	probably damaging	1.00
R1522:Rasgrf2	UTSW	13	91896086	missense	probably benign	0.00
R1553:Rasgrf2	UTSW	13	91890664	missense	probably damaging	1.00
R1613:Rasgrf2	UTSW	13	91902621	missense	probably damaging	1.00
R1883:Rasgrf2	UTSW	13	91969030	missense	probably benign
R1934:Rasgrf2	UTSW	13	91983706	splice site	probably null
R1990:Rasgrf2	UTSW	13	92035965	missense	probably damaging	1.00
R2037:Rasgrf2	UTSW	13	91902629	missense	probably damaging	0.99
R2043:Rasgrf2	UTSW	13	92030843	missense	possibly damaging	0.91
R2135:Rasgrf2	UTSW	13	91972255	missense	probably benign
R2193:Rasgrf2	UTSW	13	92023713	splice site	probably null
R2406:Rasgrf2	UTSW	13	91972240	missense	probably benign
R3055:Rasgrf2	UTSW	13	92029075	missense	probably damaging	1.00
R3916:Rasgrf2	UTSW	13	92030788	missense	probably damaging	1.00
R3954:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R3955:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R3956:Rasgrf2	UTSW	13	91982855	missense	probably damaging	0.98
R4133:Rasgrf2	UTSW	13	91982654	missense	possibly damaging	0.59
R4177:Rasgrf2	UTSW	13	91890598	missense	probably damaging	1.00
R4178:Rasgrf2	UTSW	13	91890598	missense	probably damaging	1.00
R4357:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4358:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4359:Rasgrf2	UTSW	13	91890677	missense	probably damaging	1.00
R4439:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4440:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4441:Rasgrf2	UTSW	13	91983678	missense	possibly damaging	0.95
R4564:Rasgrf2	UTSW	13	91885654	nonsense	probably null
R4576:Rasgrf2	UTSW	13	91896410	missense	possibly damaging	0.58
R4718:Rasgrf2	UTSW	13	91990830	critical splice donor site	probably null
R4778:Rasgrf2	UTSW	13	91983661	missense	probably damaging	0.99
R4790:Rasgrf2	UTSW	13	91988016	missense	probably damaging	1.00
R4808:Rasgrf2	UTSW	13	92023682	missense	probably damaging	1.00
R5151:Rasgrf2	UTSW	13	91896036	missense	probably damaging	1.00
R5286:Rasgrf2	UTSW	13	92131433	missense	possibly damaging	0.94
R5902:Rasgrf2	UTSW	13	91919892	missense	probably damaging	1.00
R6180:Rasgrf2	UTSW	13	92029101	missense	probably damaging	1.00
R6264:Rasgrf2	UTSW	13	92030785	missense	probably damaging	1.00
R6369:Rasgrf2	UTSW	13	92131446	missense	probably benign
R6428:Rasgrf2	UTSW	13	91987981	missense	probably damaging	1.00
R6595:Rasgrf2	UTSW	13	92030853	missense	probably damaging	1.00
R6619:Rasgrf2	UTSW	13	92028519	missense	probably damaging	1.00
R6988:Rasgrf2	UTSW	13	91885635	missense	probably benign	0.02
R7026:Rasgrf2	UTSW	13	91983613	missense	probably damaging	1.00
R7038:Rasgrf2	UTSW	13	91982833	missense	possibly damaging	0.95
R7045:Rasgrf2	UTSW	13	92022592	intron	probably benign
R7056:Rasgrf2	UTSW	13	92030695	missense	probably damaging	0.99
R7058:Rasgrf2	UTSW	13	91886402	missense	probably damaging	0.99
R7256:Rasgrf2	UTSW	13	91884518	nonsense	probably null
R7392:Rasgrf2	UTSW	13	91893737	missense
R7469:Rasgrf2	UTSW	13	92029022	critical splice donor site	probably null
R7618:Rasgrf2	UTSW	13	91987966	missense
R7641:Rasgrf2	UTSW	13	92131406	missense	possibly damaging	0.65
R7674:Rasgrf2	UTSW	13	92131406	missense	possibly damaging	0.65
R7784:Rasgrf2	UTSW	13	91896082	missense
R7962:Rasgrf2	UTSW	13	92030792	missense	probably damaging	0.99
R8056:Rasgrf2	UTSW	13	92030813	missense	probably damaging	0.97
R8218:Rasgrf2	UTSW	13	91982677	missense
R8796:Rasgrf2	UTSW	13	91890566	missense
R8913:Rasgrf2	UTSW	13	92022526	missense	probably benign	0.05
R8971:Rasgrf2	UTSW	13	92021717	missense	possibly damaging	0.80
R9020:Rasgrf2	UTSW	13	92028638	missense	possibly damaging	0.93
X0013:Rasgrf2	UTSW	13	92030855	missense	probably damaging	1.00
X0026:Rasgrf2	UTSW	13	91902535	missense	probably damaging	0.99
Z1177:Rasgrf2	UTSW	13	91983513	missense
Z1177:Rasgrf2	UTSW	13	92022573	missense	unknown

Predicted Primers

PCR Primer
(F):5'- ATTTGTCCCTGGCAAAAGAACTC -3'
(R):5'- GAGATGCCAGCTGTTTGATG -3'

Sequencing Primer
(F):5'- TCAGCGTGAGACTAAGTCTTTC -3'
(R):5'- GTAGGTTAGTGTGCCAGGTAGAACC -3'

Posted On

2015-09-24