Incidental Mutation 'R4591:Crocc'
ID342813
Institutional Source Beutler Lab
Gene Symbol Crocc
Ensembl Gene ENSMUSG00000040860
Gene Nameciliary rootlet coiled-coil, rootletin
Synonyms
Accession Numbers

Genbank: NM_172122;MGI: 3529431

Is this an essential gene? Possibly essential (E-score: 0.520) question?
Stock #R4591 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location141016637-141060550 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 141018672 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1712 (D1712V)
Ref Sequence ENSEMBL: ENSMUSP00000126543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040222] [ENSMUST00000071977] [ENSMUST00000097816] [ENSMUST00000102491] [ENSMUST00000166376] [ENSMUST00000168157]
Predicted Effect probably damaging
Transcript: ENSMUST00000040222
AA Change: D1712V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037679
Gene: ENSMUSG00000040860
AA Change: D1712V

DomainStartEndE-ValueType
Pfam:Rootletin 1 173 6.1e-48 PFAM
low complexity region 190 217 N/A INTRINSIC
internal_repeat_2 298 315 1.08e-6 PROSPERO
low complexity region 329 350 N/A INTRINSIC
internal_repeat_3 363 393 5.38e-6 PROSPERO
internal_repeat_6 369 392 2.67e-5 PROSPERO
low complexity region 397 411 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 624 643 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 845 875 N/A INTRINSIC
internal_repeat_4 886 904 2.67e-5 PROSPERO
internal_repeat_7 893 906 5.96e-5 PROSPERO
internal_repeat_2 893 910 1.08e-6 PROSPERO
internal_repeat_4 897 914 2.67e-5 PROSPERO
internal_repeat_1 912 937 1.97e-8 PROSPERO
internal_repeat_7 1028 1041 5.96e-5 PROSPERO
low complexity region 1107 1124 N/A INTRINSIC
internal_repeat_5 1138 1164 2.67e-5 PROSPERO
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1253 1269 N/A INTRINSIC
low complexity region 1270 1289 N/A INTRINSIC
low complexity region 1297 1309 N/A INTRINSIC
internal_repeat_6 1533 1556 2.67e-5 PROSPERO
low complexity region 1559 1576 N/A INTRINSIC
coiled coil region 1580 1707 N/A INTRINSIC
coiled coil region 1728 1832 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071977
SMART Domains Protein: ENSMUSP00000071868
Gene: ENSMUSG00000060572

DomainStartEndE-ValueType
Pfam:MAGP 3 153 1.2e-62 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000097816
AA Change: D1712V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095425
Gene: ENSMUSG00000040860
AA Change: D1712V

DomainStartEndE-ValueType
Pfam:Rootletin 1 173 6.1e-48 PFAM
low complexity region 190 217 N/A INTRINSIC
internal_repeat_2 298 315 1.08e-6 PROSPERO
low complexity region 329 350 N/A INTRINSIC
internal_repeat_3 363 393 5.38e-6 PROSPERO
internal_repeat_6 369 392 2.67e-5 PROSPERO
low complexity region 397 411 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 624 643 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 845 875 N/A INTRINSIC
internal_repeat_4 886 904 2.67e-5 PROSPERO
internal_repeat_7 893 906 5.96e-5 PROSPERO
internal_repeat_2 893 910 1.08e-6 PROSPERO
internal_repeat_4 897 914 2.67e-5 PROSPERO
internal_repeat_1 912 937 1.97e-8 PROSPERO
internal_repeat_7 1028 1041 5.96e-5 PROSPERO
low complexity region 1107 1124 N/A INTRINSIC
internal_repeat_5 1138 1164 2.67e-5 PROSPERO
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1253 1269 N/A INTRINSIC
low complexity region 1270 1289 N/A INTRINSIC
low complexity region 1297 1309 N/A INTRINSIC
internal_repeat_6 1533 1556 2.67e-5 PROSPERO
low complexity region 1559 1576 N/A INTRINSIC
coiled coil region 1580 1707 N/A INTRINSIC
coiled coil region 1728 1832 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102491
AA Change: D1876V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000099549
Gene: ENSMUSG00000040860
AA Change: D1876V

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 77 93 N/A INTRINSIC
Pfam:Rootletin 158 336 9.7e-65 PFAM
low complexity region 354 381 N/A INTRINSIC
internal_repeat_2 462 479 1.77e-6 PROSPERO
low complexity region 493 514 N/A INTRINSIC
internal_repeat_3 527 557 8.63e-6 PROSPERO
internal_repeat_6 533 556 4.21e-5 PROSPERO
low complexity region 561 575 N/A INTRINSIC
low complexity region 576 594 N/A INTRINSIC
low complexity region 617 638 N/A INTRINSIC
low complexity region 788 807 N/A INTRINSIC
low complexity region 863 880 N/A INTRINSIC
low complexity region 1009 1039 N/A INTRINSIC
internal_repeat_4 1050 1068 4.21e-5 PROSPERO
internal_repeat_7 1057 1070 9.31e-5 PROSPERO
internal_repeat_2 1057 1074 1.77e-6 PROSPERO
internal_repeat_4 1061 1078 4.21e-5 PROSPERO
internal_repeat_1 1076 1101 3.36e-8 PROSPERO
internal_repeat_7 1192 1205 9.31e-5 PROSPERO
low complexity region 1271 1288 N/A INTRINSIC
internal_repeat_5 1302 1328 4.21e-5 PROSPERO
low complexity region 1354 1365 N/A INTRINSIC
low complexity region 1417 1433 N/A INTRINSIC
low complexity region 1434 1453 N/A INTRINSIC
low complexity region 1461 1473 N/A INTRINSIC
internal_repeat_6 1697 1720 4.21e-5 PROSPERO
low complexity region 1723 1740 N/A INTRINSIC
coiled coil region 1744 1871 N/A INTRINSIC
coiled coil region 1892 1996 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122846
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124286
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126973
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137721
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151455
Predicted Effect probably benign
Transcript: ENSMUST00000166376
SMART Domains Protein: ENSMUSP00000132711
Gene: ENSMUSG00000060572

DomainStartEndE-ValueType
Pfam:MAGP 2 153 2e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168157
AA Change: D1712V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126543
Gene: ENSMUSG00000040860
AA Change: D1712V

DomainStartEndE-ValueType
Pfam:Rootletin 1 173 6.1e-48 PFAM
low complexity region 190 217 N/A INTRINSIC
internal_repeat_2 298 315 1.08e-6 PROSPERO
low complexity region 329 350 N/A INTRINSIC
internal_repeat_3 363 393 5.38e-6 PROSPERO
internal_repeat_6 369 392 2.67e-5 PROSPERO
low complexity region 397 411 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 453 474 N/A INTRINSIC
low complexity region 624 643 N/A INTRINSIC
low complexity region 699 716 N/A INTRINSIC
low complexity region 845 875 N/A INTRINSIC
internal_repeat_4 886 904 2.67e-5 PROSPERO
internal_repeat_7 893 906 5.96e-5 PROSPERO
internal_repeat_2 893 910 1.08e-6 PROSPERO
internal_repeat_4 897 914 2.67e-5 PROSPERO
internal_repeat_1 912 937 1.97e-8 PROSPERO
internal_repeat_7 1028 1041 5.96e-5 PROSPERO
low complexity region 1107 1124 N/A INTRINSIC
internal_repeat_5 1138 1164 2.67e-5 PROSPERO
low complexity region 1190 1201 N/A INTRINSIC
low complexity region 1253 1269 N/A INTRINSIC
low complexity region 1270 1289 N/A INTRINSIC
low complexity region 1297 1309 N/A INTRINSIC
internal_repeat_6 1533 1556 2.67e-5 PROSPERO
low complexity region 1559 1576 N/A INTRINSIC
coiled coil region 1580 1707 N/A INTRINSIC
coiled coil region 1728 1832 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation show no apparent functional deficits in phototransduction and ciliary beating in sensory and motile cilia. However, photoreceptors degenerate over time, and lungs appear prone to pathological changes. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Gene trapped(3)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T C 3: 68,870,266 S187P possibly damaging Het
4932438H23Rik T C 16: 91,056,071 N59S probably damaging Het
Abca15 A T 7: 120,382,413 D1030V probably damaging Het
Acmsd A T 1: 127,749,197 N153I probably damaging Het
Adprh C A 16: 38,445,983 V266L probably benign Het
Aldh5a1 G A 13: 24,924,008 P217S probably damaging Het
Alpk2 A T 18: 65,305,823 L1300Q probably benign Het
Alyref C T 11: 120,595,973 R154Q probably benign Het
Ano6 T A 15: 95,943,427 C468* probably null Het
Aox3 A T 1: 58,152,656 I456F probably damaging Het
Art4 A G 6: 136,854,757 Y129H probably damaging Het
Asb16 C A 11: 102,276,725 H306N probably damaging Het
Atp8a2 C A 14: 59,654,629 R1090L probably benign Het
Brap G T 5: 121,662,050 V1F probably null Het
C1qb C A 4: 136,882,217 G31W probably damaging Het
Cacna2d4 T C 6: 119,298,464 Y666H probably benign Het
Casr T C 16: 36,500,370 N472S probably benign Het
Ccdc91 T G 6: 147,590,465 S282A unknown Het
Cd300lg A G 11: 102,046,180 T164A probably benign Het
Cd79b A T 11: 106,312,046 D243E probably damaging Het
Cdh6 C A 15: 13,051,486 V354F possibly damaging Het
Cdhr2 A G 13: 54,715,684 N126S probably benign Het
Cep192 A T 18: 67,834,968 N841I probably damaging Het
Cngb1 T C 8: 95,253,384 T963A probably damaging Het
Col16a1 A G 4: 130,061,799 probably null Het
Coro1a A G 7: 126,702,992 V61A probably damaging Het
Ddn T C 15: 98,807,806 D3G possibly damaging Het
Dnal1 T C 12: 84,133,853 F89S probably benign Het
Dusp3 T A 11: 101,973,620 probably benign Het
Dyrk3 C A 1: 131,130,158 G58C probably damaging Het
Fat1 T C 8: 45,026,242 F2775S probably benign Het
Frk A G 10: 34,605,833 N373S probably benign Het
Glmn A G 5: 107,561,051 probably null Het
Gm11565 A T 11: 99,914,943 T54S possibly damaging Het
Gm14410 A G 2: 177,194,027 I148T possibly damaging Het
Gm21834 T A 17: 57,741,885 H112L possibly damaging Het
Gm5862 A G 5: 26,019,488 I161T possibly damaging Het
Grid2 G T 6: 64,320,102 G483V probably damaging Het
Hfm1 A T 5: 106,847,667 S1293T probably benign Het
Il1a G A 2: 129,306,527 R88W probably damaging Het
Il20rb A T 9: 100,474,990 V29D possibly damaging Het
Ilvbl C T 10: 78,583,305 L463F probably benign Het
Kif17 A G 4: 138,277,799 E225G probably benign Het
Lrp2 A G 2: 69,536,075 F227L probably damaging Het
Lrrc43 A G 5: 123,501,164 M419V probably benign Het
Magel2 A G 7: 62,381,089 Q1247R unknown Het
Mamdc4 T A 2: 25,564,597 M1068L possibly damaging Het
Marc1 T C 1: 184,807,168 E102G probably benign Het
Mdn1 T G 4: 32,707,636 S1642A probably damaging Het
Mtcl1 T C 17: 66,348,511 E819G probably benign Het
Naa15 T C 3: 51,441,924 L38P probably damaging Het
Nlrp3 A G 11: 59,549,222 R542G probably benign Het
Olfr1456-ps1 ACAC ACACGCAC 19: 13,078,902 noncoding transcript Het
Olfr201 A C 16: 59,269,413 F85V possibly damaging Het
Olfr462 A G 11: 87,889,549 S116P probably benign Het
Olfr95 C T 17: 37,211,119 V245I probably benign Het
Pbxip1 T A 3: 89,446,160 L249Q probably benign Het
Pla2g7 T C 17: 43,600,559 S201P probably damaging Het
Psmd1 G T 1: 86,128,204 V763F probably benign Het
Ptp4a2 A G 4: 129,846,515 E124G probably benign Het
Rab6b T C 9: 103,167,174 probably null Het
Rbks T A 5: 31,660,008 K139M possibly damaging Het
Rgs22 T A 15: 36,100,136 E268D probably benign Het
Slc16a9 T G 10: 70,282,880 L343R probably damaging Het
Smagp T C 15: 100,621,979 I55V probably damaging Het
Sox13 T C 1: 133,383,683 S604G probably damaging Het
St6gal1 G T 16: 23,321,294 V72F probably benign Het
Stxbp4 A G 11: 90,594,780 V247A probably benign Het
Susd3 A T 13: 49,231,260 M217K possibly damaging Het
Tas2r129 T A 6: 132,951,611 N170K probably benign Het
Tmem245 C A 4: 56,910,204 A515S probably damaging Het
Tpte T C 8: 22,327,775 V259A probably benign Het
Trpa1 T C 1: 14,882,108 probably null Het
Ttc28 G A 5: 111,223,281 R532H probably damaging Het
Vwa5a A T 9: 38,735,620 N529I possibly damaging Het
Zfp574 T C 7: 25,079,544 probably benign Het
Other mutations in Crocc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Crocc APN 4 141022112 missense probably damaging 1.00
IGL01474:Crocc APN 4 141035392 splice site probably benign
IGL01859:Crocc APN 4 141029290 missense probably benign 0.07
IGL02161:Crocc APN 4 141033991 missense probably benign 0.01
IGL02244:Crocc APN 4 141037920 missense probably benign 0.00
IGL02970:Crocc APN 4 141030246 missense possibly damaging 0.49
N/A:Crocc UTSW 4 141021746 missense probably damaging 1.00
R0158:Crocc UTSW 4 141042242 splice site probably benign
R0280:Crocc UTSW 4 141028426 missense probably damaging 1.00
R0448:Crocc UTSW 4 141042191 missense probably damaging 1.00
R0532:Crocc UTSW 4 141030247 missense possibly damaging 0.95
R0597:Crocc UTSW 4 141019913 missense probably benign 0.06
R0597:Crocc UTSW 4 141017071 missense probably benign
R0761:Crocc UTSW 4 141029776 missense probably benign 0.00
R0761:Crocc UTSW 4 141047076 missense probably benign 0.01
R1238:Crocc UTSW 4 141035364 missense probably benign 0.00
R1460:Crocc UTSW 4 141029240 nonsense probably null
R1515:Crocc UTSW 4 141019737 missense probably benign 0.00
R1557:Crocc UTSW 4 141025465 missense probably damaging 0.96
R1561:Crocc UTSW 4 141030268 missense probably damaging 1.00
R1641:Crocc UTSW 4 141017077 missense probably benign 0.00
R1709:Crocc UTSW 4 141026099 critical splice donor site probably null
R1785:Crocc UTSW 4 141021802 missense probably damaging 0.99
R1786:Crocc UTSW 4 141021802 missense probably damaging 0.99
R1793:Crocc UTSW 4 141019309 missense probably damaging 1.00
R1897:Crocc UTSW 4 141018736 missense probably damaging 1.00
R1935:Crocc UTSW 4 141034058 missense possibly damaging 0.78
R2037:Crocc UTSW 4 141046942 critical splice donor site probably null
R2127:Crocc UTSW 4 141017096 missense probably damaging 1.00
R2129:Crocc UTSW 4 141017096 missense probably damaging 1.00
R2130:Crocc UTSW 4 141029102 missense probably benign 0.04
R2136:Crocc UTSW 4 141032954 missense probably damaging 1.00
R2298:Crocc UTSW 4 141025459 missense probably benign 0.30
R2847:Crocc UTSW 4 141018756 missense probably damaging 0.97
R2848:Crocc UTSW 4 141018756 missense probably damaging 0.97
R2913:Crocc UTSW 4 141020350 missense probably damaging 1.00
R3415:Crocc UTSW 4 141046447 missense possibly damaging 0.75
R3416:Crocc UTSW 4 141046447 missense possibly damaging 0.75
R3417:Crocc UTSW 4 141046447 missense possibly damaging 0.75
R4082:Crocc UTSW 4 141033971 splice site probably null
R4454:Crocc UTSW 4 141020405 missense possibly damaging 0.52
R4597:Crocc UTSW 4 141019777 missense probably damaging 1.00
R4984:Crocc UTSW 4 141034452 missense probably damaging 1.00
R4992:Crocc UTSW 4 141046666 missense probably damaging 0.98
R5109:Crocc UTSW 4 141028411 missense probably damaging 1.00
R5143:Crocc UTSW 4 141041039 missense probably benign 0.01
R5381:Crocc UTSW 4 141029311 missense possibly damaging 0.95
R5684:Crocc UTSW 4 141051144 missense probably damaging 0.99
R5757:Crocc UTSW 4 141043564 missense probably damaging 1.00
R5795:Crocc UTSW 4 141041807 frame shift probably null
R5796:Crocc UTSW 4 141041807 frame shift probably null
R5798:Crocc UTSW 4 141041807 frame shift probably null
R5815:Crocc UTSW 4 141035196 missense probably damaging 0.99
R5955:Crocc UTSW 4 141017918 missense possibly damaging 0.75
R6031:Crocc UTSW 4 141034357 critical splice donor site probably null
R6063:Crocc UTSW 4 141041721 missense probably benign 0.08
R6063:Crocc UTSW 4 141046540 missense probably damaging 1.00
R7086:Crocc UTSW 4 141047057 missense possibly damaging 0.47
R7282:Crocc UTSW 4 141022341 missense probably damaging 1.00
R7293:Crocc UTSW 4 141043556 missense probably benign 0.17
R7404:Crocc UTSW 4 141026186 missense possibly damaging 0.46
R7571:Crocc UTSW 4 141046049 critical splice acceptor site probably null
R7646:Crocc UTSW 4 141021655 missense probably null 0.94
R7782:Crocc UTSW 4 141025286 missense probably benign 0.05
R8053:Crocc UTSW 4 141042919 critical splice donor site probably null
X0065:Crocc UTSW 4 141041792 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- GCTCCACCTAGGTAAGAATATAGAG -3'
(R):5'- GTTGAGATAGTCACCCTGAGG -3'

Sequencing Primer
(F):5'- ATTTCTGAGTTCGAGGCCAGCC -3'
(R):5'- TGGGATGAAGGCCTGCC -3'
Posted On2015-09-24