Incidental Mutation 'R4591:Hfm1'
ID 342816
Institutional Source Beutler Lab
Gene Symbol Hfm1
Ensembl Gene ENSMUSG00000043410
Gene Name HFM1, ATP-dependent DNA helicase homolog
Synonyms LOC381663, A330009G12Rik, Mer3, Sec63d1
Accession Numbers
Essential gene? Probably non essential (E-score: 0.089) question?
Stock # R4591 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 106988058-107074187 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 106995533 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 1293 (S1293T)
Ref Sequence ENSEMBL: ENSMUSP00000112590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112690] [ENSMUST00000117588] [ENSMUST00000148495]
AlphaFold D3Z4R1
Predicted Effect probably benign
Transcript: ENSMUST00000112690
AA Change: S1293T

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000108310
Gene: ENSMUSG00000043410
AA Change: S1293T

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000117588
AA Change: S1293T

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000112590
Gene: ENSMUSG00000043410
AA Change: S1293T

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148495
Predicted Effect unknown
Transcript: ENSMUST00000155171
AA Change: S506T
SMART Domains Protein: ENSMUSP00000118674
Gene: ENSMUSG00000043410
AA Change: S506T

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
Sec63 33 304 3.04e-42 SMART
Blast:Sec63 344 402 7e-19 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be an ATP-dependent DNA helicase and is expressed mainly in germ-line cells. Defects in this gene are a cause of premature ovarian failure 9 (POF9). [provided by RefSeq, Apr 2014]
PHENOTYPE: Meiosis ais disrupted in homozygotes and bothe sexes are sterile [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T C 3: 68,777,599 (GRCm39) S187P possibly damaging Het
4932438H23Rik T C 16: 90,852,959 (GRCm39) N59S probably damaging Het
Abca15 A T 7: 119,981,636 (GRCm39) D1030V probably damaging Het
Acmsd A T 1: 127,676,934 (GRCm39) N153I probably damaging Het
Adprh C A 16: 38,266,345 (GRCm39) V266L probably benign Het
Aldh5a1 G A 13: 25,107,991 (GRCm39) P217S probably damaging Het
Alpk2 A T 18: 65,438,894 (GRCm39) L1300Q probably benign Het
Alyref C T 11: 120,486,799 (GRCm39) R154Q probably benign Het
Ano6 T A 15: 95,841,308 (GRCm39) C468* probably null Het
Aox3 A T 1: 58,191,815 (GRCm39) I456F probably damaging Het
Art4 A G 6: 136,831,755 (GRCm39) Y129H probably damaging Het
Asb16 C A 11: 102,167,551 (GRCm39) H306N probably damaging Het
Atp8a2 C A 14: 59,892,078 (GRCm39) R1090L probably benign Het
Brap G T 5: 121,800,113 (GRCm39) V1F probably null Het
C1qb C A 4: 136,609,528 (GRCm39) G31W probably damaging Het
Cacna2d4 T C 6: 119,275,425 (GRCm39) Y666H probably benign Het
Casr T C 16: 36,320,732 (GRCm39) N472S probably benign Het
Ccdc91 T G 6: 147,491,963 (GRCm39) S282A unknown Het
Cd300lg A G 11: 101,937,006 (GRCm39) T164A probably benign Het
Cd79b A T 11: 106,202,872 (GRCm39) D243E probably damaging Het
Cdh6 C A 15: 13,051,572 (GRCm39) V354F possibly damaging Het
Cdhr2 A G 13: 54,863,497 (GRCm39) N126S probably benign Het
Cep192 A T 18: 67,968,039 (GRCm39) N841I probably damaging Het
Cngb1 T C 8: 95,980,012 (GRCm39) T963A probably damaging Het
Col16a1 A G 4: 129,955,592 (GRCm39) probably null Het
Coro1a A G 7: 126,302,164 (GRCm39) V61A probably damaging Het
Crocc T A 4: 140,745,983 (GRCm39) D1712V probably damaging Het
Ddn T C 15: 98,705,687 (GRCm39) D3G possibly damaging Het
Dnal1 T C 12: 84,180,627 (GRCm39) F89S probably benign Het
Dusp3 T A 11: 101,864,446 (GRCm39) probably benign Het
Dyrk3 C A 1: 131,057,895 (GRCm39) G58C probably damaging Het
Fat1 T C 8: 45,479,279 (GRCm39) F2775S probably benign Het
Frk A G 10: 34,481,829 (GRCm39) N373S probably benign Het
Glmn A G 5: 107,708,917 (GRCm39) probably null Het
Gm11565 A T 11: 99,805,769 (GRCm39) T54S possibly damaging Het
Gm14410 A G 2: 176,885,820 (GRCm39) I148T possibly damaging Het
Gm21834 T A 17: 58,048,880 (GRCm39) H112L possibly damaging Het
Gm5862 A G 5: 26,224,486 (GRCm39) I161T possibly damaging Het
Grid2 G T 6: 64,297,086 (GRCm39) G483V probably damaging Het
Il1a G A 2: 129,148,447 (GRCm39) R88W probably damaging Het
Il20rb A T 9: 100,357,043 (GRCm39) V29D possibly damaging Het
Ilvbl C T 10: 78,419,139 (GRCm39) L463F probably benign Het
Kif17 A G 4: 138,005,110 (GRCm39) E225G probably benign Het
Lrp2 A G 2: 69,366,419 (GRCm39) F227L probably damaging Het
Lrrc43 A G 5: 123,639,227 (GRCm39) M419V probably benign Het
Magel2 A G 7: 62,030,837 (GRCm39) Q1247R unknown Het
Mamdc4 T A 2: 25,454,609 (GRCm39) M1068L possibly damaging Het
Mdn1 T G 4: 32,707,636 (GRCm39) S1642A probably damaging Het
Mtarc1 T C 1: 184,539,365 (GRCm39) E102G probably benign Het
Mtcl1 T C 17: 66,655,506 (GRCm39) E819G probably benign Het
Naa15 T C 3: 51,349,345 (GRCm39) L38P probably damaging Het
Nlrp3 A G 11: 59,440,048 (GRCm39) R542G probably benign Het
Or10c1 C T 17: 37,522,010 (GRCm39) V245I probably benign Het
Or4d2b A G 11: 87,780,375 (GRCm39) S116P probably benign Het
Or5ac19 A C 16: 59,089,776 (GRCm39) F85V possibly damaging Het
Or5b125-ps1 ACAC ACACGCAC 19: 13,056,266 (GRCm39) noncoding transcript Het
Pbxip1 T A 3: 89,353,467 (GRCm39) L249Q probably benign Het
Pla2g7 T C 17: 43,911,450 (GRCm39) S201P probably damaging Het
Psmd1 G T 1: 86,055,926 (GRCm39) V763F probably benign Het
Ptp4a2 A G 4: 129,740,308 (GRCm39) E124G probably benign Het
Rab6b T C 9: 103,044,373 (GRCm39) probably null Het
Rbks T A 5: 31,817,352 (GRCm39) K139M possibly damaging Het
Rgs22 T A 15: 36,100,282 (GRCm39) E268D probably benign Het
Slc16a9 T G 10: 70,118,710 (GRCm39) L343R probably damaging Het
Smagp T C 15: 100,519,860 (GRCm39) I55V probably damaging Het
Sox13 T C 1: 133,311,421 (GRCm39) S604G probably damaging Het
St6gal1 G T 16: 23,140,044 (GRCm39) V72F probably benign Het
Stxbp4 A G 11: 90,485,606 (GRCm39) V247A probably benign Het
Susd3 A T 13: 49,384,736 (GRCm39) M217K possibly damaging Het
Tas2r129 T A 6: 132,928,574 (GRCm39) N170K probably benign Het
Tmem245 C A 4: 56,910,204 (GRCm39) A515S probably damaging Het
Tpte T C 8: 22,817,791 (GRCm39) V259A probably benign Het
Trpa1 T C 1: 14,952,332 (GRCm39) probably null Het
Ttc28 G A 5: 111,371,147 (GRCm39) R532H probably damaging Het
Vwa5a A T 9: 38,646,916 (GRCm39) N529I possibly damaging Het
Zfp574 T C 7: 24,778,969 (GRCm39) probably benign Het
Other mutations in Hfm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Hfm1 APN 5 107,049,996 (GRCm39) missense possibly damaging 0.70
IGL01295:Hfm1 APN 5 107,065,472 (GRCm39) missense possibly damaging 0.46
IGL01725:Hfm1 APN 5 107,065,245 (GRCm39) missense probably benign 0.00
IGL01758:Hfm1 APN 5 107,052,659 (GRCm39) missense probably damaging 0.99
IGL01911:Hfm1 APN 5 107,059,410 (GRCm39) missense possibly damaging 0.92
IGL02337:Hfm1 APN 5 107,052,133 (GRCm39) missense possibly damaging 0.81
IGL02472:Hfm1 APN 5 107,021,794 (GRCm39) splice site probably benign
IGL02496:Hfm1 APN 5 107,049,627 (GRCm39) missense probably benign 0.00
IGL02545:Hfm1 APN 5 107,043,153 (GRCm39) missense probably damaging 1.00
IGL02584:Hfm1 APN 5 107,026,528 (GRCm39) splice site probably null
IGL02728:Hfm1 APN 5 107,026,689 (GRCm39) missense probably benign 0.13
IGL02881:Hfm1 APN 5 107,022,118 (GRCm39) missense probably damaging 1.00
IGL03108:Hfm1 APN 5 107,043,800 (GRCm39) unclassified probably benign
IGL03351:Hfm1 APN 5 107,059,441 (GRCm39) nonsense probably null
IGL03353:Hfm1 APN 5 107,004,795 (GRCm39) missense probably damaging 0.99
R0024:Hfm1 UTSW 5 107,004,790 (GRCm39) missense probably benign 0.41
R0024:Hfm1 UTSW 5 107,004,790 (GRCm39) missense probably benign 0.41
R0094:Hfm1 UTSW 5 107,065,344 (GRCm39) missense probably benign
R0633:Hfm1 UTSW 5 107,065,467 (GRCm39) missense possibly damaging 0.56
R0644:Hfm1 UTSW 5 107,046,122 (GRCm39) critical splice donor site probably null
R1078:Hfm1 UTSW 5 107,026,696 (GRCm39) missense probably damaging 1.00
R1120:Hfm1 UTSW 5 107,052,084 (GRCm39) splice site probably benign
R1166:Hfm1 UTSW 5 107,059,277 (GRCm39) missense probably benign 0.00
R1242:Hfm1 UTSW 5 107,022,767 (GRCm39) missense probably damaging 0.99
R1414:Hfm1 UTSW 5 107,020,219 (GRCm39) missense probably benign 0.01
R1450:Hfm1 UTSW 5 107,066,324 (GRCm39) missense probably damaging 0.99
R1529:Hfm1 UTSW 5 107,000,989 (GRCm39) missense probably benign 0.00
R1622:Hfm1 UTSW 5 107,041,389 (GRCm39) missense possibly damaging 0.58
R1710:Hfm1 UTSW 5 107,043,869 (GRCm39) missense probably damaging 0.96
R1710:Hfm1 UTSW 5 107,028,380 (GRCm39) missense probably damaging 1.00
R1757:Hfm1 UTSW 5 107,028,226 (GRCm39) splice site probably null
R1856:Hfm1 UTSW 5 106,995,542 (GRCm39) missense probably benign 0.00
R1984:Hfm1 UTSW 5 107,046,442 (GRCm39) missense probably damaging 0.98
R1985:Hfm1 UTSW 5 107,046,442 (GRCm39) missense probably damaging 0.98
R2040:Hfm1 UTSW 5 107,049,684 (GRCm39) missense probably damaging 1.00
R2122:Hfm1 UTSW 5 107,044,121 (GRCm39) missense probably damaging 1.00
R2426:Hfm1 UTSW 5 106,995,519 (GRCm39) splice site probably null
R2474:Hfm1 UTSW 5 107,020,282 (GRCm39) missense possibly damaging 0.81
R2926:Hfm1 UTSW 5 107,022,148 (GRCm39) nonsense probably null
R2944:Hfm1 UTSW 5 107,020,196 (GRCm39) missense probably damaging 1.00
R3705:Hfm1 UTSW 5 107,040,705 (GRCm39) unclassified probably benign
R4256:Hfm1 UTSW 5 107,052,663 (GRCm39) missense possibly damaging 0.83
R4455:Hfm1 UTSW 5 107,034,374 (GRCm39) splice site probably null
R4538:Hfm1 UTSW 5 107,022,756 (GRCm39) missense possibly damaging 0.47
R4540:Hfm1 UTSW 5 107,022,087 (GRCm39) nonsense probably null
R4745:Hfm1 UTSW 5 107,049,709 (GRCm39) missense possibly damaging 0.87
R4747:Hfm1 UTSW 5 107,065,389 (GRCm39) missense probably benign
R4765:Hfm1 UTSW 5 106,990,405 (GRCm39) missense probably benign 0.21
R4821:Hfm1 UTSW 5 107,002,606 (GRCm39) critical splice donor site probably null
R4842:Hfm1 UTSW 5 107,040,617 (GRCm39) missense probably damaging 1.00
R4944:Hfm1 UTSW 5 107,022,079 (GRCm39) missense possibly damaging 0.46
R5093:Hfm1 UTSW 5 107,049,597 (GRCm39) missense probably damaging 1.00
R5399:Hfm1 UTSW 5 107,065,428 (GRCm39) missense possibly damaging 0.91
R5414:Hfm1 UTSW 5 107,049,942 (GRCm39) missense probably damaging 1.00
R5436:Hfm1 UTSW 5 107,040,638 (GRCm39) missense possibly damaging 0.61
R5459:Hfm1 UTSW 5 107,052,629 (GRCm39) missense probably damaging 1.00
R5485:Hfm1 UTSW 5 106,995,528 (GRCm39) critical splice donor site probably null
R5585:Hfm1 UTSW 5 107,059,305 (GRCm39) missense probably benign 0.05
R5631:Hfm1 UTSW 5 107,052,629 (GRCm39) missense probably damaging 1.00
R5705:Hfm1 UTSW 5 107,059,319 (GRCm39) missense probably benign 0.21
R5804:Hfm1 UTSW 5 107,026,455 (GRCm39) splice site probably null
R5959:Hfm1 UTSW 5 107,022,783 (GRCm39) missense probably damaging 1.00
R6046:Hfm1 UTSW 5 107,046,509 (GRCm39) splice site probably null
R6191:Hfm1 UTSW 5 107,034,419 (GRCm39) missense possibly damaging 0.95
R6345:Hfm1 UTSW 5 106,989,504 (GRCm39) missense probably benign
R6580:Hfm1 UTSW 5 106,995,575 (GRCm39) missense probably benign 0.00
R6651:Hfm1 UTSW 5 106,995,553 (GRCm39) missense probably benign 0.00
R6761:Hfm1 UTSW 5 107,043,145 (GRCm39) missense probably damaging 1.00
R6835:Hfm1 UTSW 5 107,026,681 (GRCm39) nonsense probably null
R6891:Hfm1 UTSW 5 107,065,240 (GRCm39) missense possibly damaging 0.49
R6924:Hfm1 UTSW 5 106,998,276 (GRCm39) splice site probably null
R6980:Hfm1 UTSW 5 107,028,343 (GRCm39) missense probably benign 0.31
R7054:Hfm1 UTSW 5 107,043,909 (GRCm39) missense probably benign 0.01
R7058:Hfm1 UTSW 5 107,059,306 (GRCm39) missense probably benign 0.04
R7189:Hfm1 UTSW 5 107,049,569 (GRCm39) critical splice donor site probably null
R7250:Hfm1 UTSW 5 107,052,197 (GRCm39) missense probably benign 0.00
R7376:Hfm1 UTSW 5 107,043,084 (GRCm39) missense possibly damaging 0.95
R7577:Hfm1 UTSW 5 107,043,909 (GRCm39) missense probably benign 0.01
R7636:Hfm1 UTSW 5 107,065,332 (GRCm39) missense probably benign 0.02
R7639:Hfm1 UTSW 5 107,046,341 (GRCm39) missense possibly damaging 0.46
R7639:Hfm1 UTSW 5 107,037,791 (GRCm39) missense probably benign 0.03
R7763:Hfm1 UTSW 5 107,029,727 (GRCm39) missense probably damaging 1.00
R7828:Hfm1 UTSW 5 107,029,657 (GRCm39) critical splice donor site probably null
R7905:Hfm1 UTSW 5 107,046,419 (GRCm39) missense probably damaging 1.00
R8160:Hfm1 UTSW 5 107,043,899 (GRCm39) missense probably null 0.00
R8477:Hfm1 UTSW 5 107,029,684 (GRCm39) missense probably benign 0.01
R8739:Hfm1 UTSW 5 107,046,371 (GRCm39) missense probably damaging 0.96
R8968:Hfm1 UTSW 5 107,065,439 (GRCm39) missense probably benign 0.00
R9072:Hfm1 UTSW 5 107,046,146 (GRCm39) missense probably benign 0.04
R9073:Hfm1 UTSW 5 107,046,146 (GRCm39) missense probably benign 0.04
R9152:Hfm1 UTSW 5 106,989,611 (GRCm39) missense probably benign 0.01
R9234:Hfm1 UTSW 5 107,041,334 (GRCm39) missense probably benign
R9244:Hfm1 UTSW 5 107,022,766 (GRCm39) missense probably damaging 0.96
R9576:Hfm1 UTSW 5 107,021,938 (GRCm39) missense probably benign 0.00
R9649:Hfm1 UTSW 5 107,066,329 (GRCm39) missense possibly damaging 0.82
R9743:Hfm1 UTSW 5 107,022,125 (GRCm39) missense possibly damaging 0.55
R9782:Hfm1 UTSW 5 107,021,896 (GRCm39) missense probably benign 0.38
R9789:Hfm1 UTSW 5 107,065,346 (GRCm39) missense probably benign 0.00
Z1177:Hfm1 UTSW 5 107,019,686 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAGGGAAAATGCTCTTTGTGG -3'
(R):5'- AAACGGTGATGTTCAGCAGGC -3'

Sequencing Primer
(F):5'- GGAAAATGCTCTTTGTGGAAAAG -3'
(R):5'- GGCATGCTAATATACCTGGAAAC -3'
Posted On 2015-09-24