Incidental Mutation 'R4591:Hfm1'
ID 342816
Institutional Source Beutler Lab
Gene Symbol Hfm1
Ensembl Gene ENSMUSG00000043410
Gene Name HFM1, ATP-dependent DNA helicase homolog
Synonyms LOC381663, A330009G12Rik, Mer3, Sec63d1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock # R4591 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 106840192-106926321 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 106847667 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 1293 (S1293T)
Ref Sequence ENSEMBL: ENSMUSP00000112590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112690] [ENSMUST00000117588] [ENSMUST00000148495]
AlphaFold D3Z4R1
Predicted Effect probably benign
Transcript: ENSMUST00000112690
AA Change: S1293T

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000108310
Gene: ENSMUSG00000043410
AA Change: S1293T

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000117588
AA Change: S1293T

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000112590
Gene: ENSMUSG00000043410
AA Change: S1293T

DomainStartEndE-ValueType
DEXDc 276 490 3.66e-29 SMART
HELICc 571 657 1.56e-14 SMART
low complexity region 751 764 N/A INTRINSIC
Sec63 775 1090 5.66e-60 SMART
Blast:Sec63 1130 1188 2e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000148495
Predicted Effect unknown
Transcript: ENSMUST00000155171
AA Change: S506T
SMART Domains Protein: ENSMUSP00000118674
Gene: ENSMUSG00000043410
AA Change: S506T

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
Sec63 33 304 3.04e-42 SMART
Blast:Sec63 344 402 7e-19 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be an ATP-dependent DNA helicase and is expressed mainly in germ-line cells. Defects in this gene are a cause of premature ovarian failure 9 (POF9). [provided by RefSeq, Apr 2014]
PHENOTYPE: Meiosis ais disrupted in homozygotes and bothe sexes are sterile [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T C 3: 68,870,266 S187P possibly damaging Het
4932438H23Rik T C 16: 91,056,071 N59S probably damaging Het
Abca15 A T 7: 120,382,413 D1030V probably damaging Het
Acmsd A T 1: 127,749,197 N153I probably damaging Het
Adprh C A 16: 38,445,983 V266L probably benign Het
Aldh5a1 G A 13: 24,924,008 P217S probably damaging Het
Alpk2 A T 18: 65,305,823 L1300Q probably benign Het
Alyref C T 11: 120,595,973 R154Q probably benign Het
Ano6 T A 15: 95,943,427 C468* probably null Het
Aox3 A T 1: 58,152,656 I456F probably damaging Het
Art4 A G 6: 136,854,757 Y129H probably damaging Het
Asb16 C A 11: 102,276,725 H306N probably damaging Het
Atp8a2 C A 14: 59,654,629 R1090L probably benign Het
Brap G T 5: 121,662,050 V1F probably null Het
C1qb C A 4: 136,882,217 G31W probably damaging Het
Cacna2d4 T C 6: 119,298,464 Y666H probably benign Het
Casr T C 16: 36,500,370 N472S probably benign Het
Ccdc91 T G 6: 147,590,465 S282A unknown Het
Cd300lg A G 11: 102,046,180 T164A probably benign Het
Cd79b A T 11: 106,312,046 D243E probably damaging Het
Cdh6 C A 15: 13,051,486 V354F possibly damaging Het
Cdhr2 A G 13: 54,715,684 N126S probably benign Het
Cep192 A T 18: 67,834,968 N841I probably damaging Het
Cngb1 T C 8: 95,253,384 T963A probably damaging Het
Col16a1 A G 4: 130,061,799 probably null Het
Coro1a A G 7: 126,702,992 V61A probably damaging Het
Crocc T A 4: 141,018,672 D1712V probably damaging Het
Ddn T C 15: 98,807,806 D3G possibly damaging Het
Dnal1 T C 12: 84,133,853 F89S probably benign Het
Dusp3 T A 11: 101,973,620 probably benign Het
Dyrk3 C A 1: 131,130,158 G58C probably damaging Het
Fat1 T C 8: 45,026,242 F2775S probably benign Het
Frk A G 10: 34,605,833 N373S probably benign Het
Glmn A G 5: 107,561,051 probably null Het
Gm11565 A T 11: 99,914,943 T54S possibly damaging Het
Gm14410 A G 2: 177,194,027 I148T possibly damaging Het
Gm21834 T A 17: 57,741,885 H112L possibly damaging Het
Gm5862 A G 5: 26,019,488 I161T possibly damaging Het
Grid2 G T 6: 64,320,102 G483V probably damaging Het
Il1a G A 2: 129,306,527 R88W probably damaging Het
Il20rb A T 9: 100,474,990 V29D possibly damaging Het
Ilvbl C T 10: 78,583,305 L463F probably benign Het
Kif17 A G 4: 138,277,799 E225G probably benign Het
Lrp2 A G 2: 69,536,075 F227L probably damaging Het
Lrrc43 A G 5: 123,501,164 M419V probably benign Het
Magel2 A G 7: 62,381,089 Q1247R unknown Het
Mamdc4 T A 2: 25,564,597 M1068L possibly damaging Het
Marc1 T C 1: 184,807,168 E102G probably benign Het
Mdn1 T G 4: 32,707,636 S1642A probably damaging Het
Mtcl1 T C 17: 66,348,511 E819G probably benign Het
Naa15 T C 3: 51,441,924 L38P probably damaging Het
Nlrp3 A G 11: 59,549,222 R542G probably benign Het
Olfr1456-ps1 ACAC ACACGCAC 19: 13,078,902 noncoding transcript Het
Olfr201 A C 16: 59,269,413 F85V possibly damaging Het
Olfr462 A G 11: 87,889,549 S116P probably benign Het
Olfr95 C T 17: 37,211,119 V245I probably benign Het
Pbxip1 T A 3: 89,446,160 L249Q probably benign Het
Pla2g7 T C 17: 43,600,559 S201P probably damaging Het
Psmd1 G T 1: 86,128,204 V763F probably benign Het
Ptp4a2 A G 4: 129,846,515 E124G probably benign Het
Rab6b T C 9: 103,167,174 probably null Het
Rbks T A 5: 31,660,008 K139M possibly damaging Het
Rgs22 T A 15: 36,100,136 E268D probably benign Het
Slc16a9 T G 10: 70,282,880 L343R probably damaging Het
Smagp T C 15: 100,621,979 I55V probably damaging Het
Sox13 T C 1: 133,383,683 S604G probably damaging Het
St6gal1 G T 16: 23,321,294 V72F probably benign Het
Stxbp4 A G 11: 90,594,780 V247A probably benign Het
Susd3 A T 13: 49,231,260 M217K possibly damaging Het
Tas2r129 T A 6: 132,951,611 N170K probably benign Het
Tmem245 C A 4: 56,910,204 A515S probably damaging Het
Tpte T C 8: 22,327,775 V259A probably benign Het
Trpa1 T C 1: 14,882,108 probably null Het
Ttc28 G A 5: 111,223,281 R532H probably damaging Het
Vwa5a A T 9: 38,735,620 N529I possibly damaging Het
Zfp574 T C 7: 25,079,544 probably benign Het
Other mutations in Hfm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Hfm1 APN 5 106902130 missense possibly damaging 0.70
IGL01295:Hfm1 APN 5 106917606 missense possibly damaging 0.46
IGL01725:Hfm1 APN 5 106917379 missense probably benign 0.00
IGL01758:Hfm1 APN 5 106904793 missense probably damaging 0.99
IGL01911:Hfm1 APN 5 106911544 missense possibly damaging 0.92
IGL02337:Hfm1 APN 5 106904267 missense possibly damaging 0.81
IGL02472:Hfm1 APN 5 106873928 splice site probably benign
IGL02496:Hfm1 APN 5 106901761 missense probably benign 0.00
IGL02545:Hfm1 APN 5 106895287 missense probably damaging 1.00
IGL02584:Hfm1 APN 5 106878662 splice site probably null
IGL02728:Hfm1 APN 5 106878823 missense probably benign 0.13
IGL02881:Hfm1 APN 5 106874252 missense probably damaging 1.00
IGL03108:Hfm1 APN 5 106895934 unclassified probably benign
IGL03351:Hfm1 APN 5 106911575 nonsense probably null
IGL03353:Hfm1 APN 5 106856929 missense probably damaging 0.99
R0024:Hfm1 UTSW 5 106856924 missense probably benign 0.41
R0024:Hfm1 UTSW 5 106856924 missense probably benign 0.41
R0094:Hfm1 UTSW 5 106917478 missense probably benign
R0633:Hfm1 UTSW 5 106917601 missense possibly damaging 0.56
R0644:Hfm1 UTSW 5 106898256 critical splice donor site probably null
R1078:Hfm1 UTSW 5 106878830 missense probably damaging 1.00
R1120:Hfm1 UTSW 5 106904218 splice site probably benign
R1166:Hfm1 UTSW 5 106911411 missense probably benign 0.00
R1242:Hfm1 UTSW 5 106874901 missense probably damaging 0.99
R1414:Hfm1 UTSW 5 106872353 missense probably benign 0.01
R1450:Hfm1 UTSW 5 106918458 missense probably damaging 0.99
R1529:Hfm1 UTSW 5 106853123 missense probably benign 0.00
R1622:Hfm1 UTSW 5 106893523 missense possibly damaging 0.58
R1710:Hfm1 UTSW 5 106880514 missense probably damaging 1.00
R1710:Hfm1 UTSW 5 106896003 missense probably damaging 0.96
R1757:Hfm1 UTSW 5 106880360 splice site probably null
R1856:Hfm1 UTSW 5 106847676 missense probably benign 0.00
R1984:Hfm1 UTSW 5 106898576 missense probably damaging 0.98
R1985:Hfm1 UTSW 5 106898576 missense probably damaging 0.98
R2040:Hfm1 UTSW 5 106901818 missense probably damaging 1.00
R2122:Hfm1 UTSW 5 106896255 missense probably damaging 1.00
R2426:Hfm1 UTSW 5 106847653 splice site probably null
R2474:Hfm1 UTSW 5 106872416 missense possibly damaging 0.81
R2926:Hfm1 UTSW 5 106874282 nonsense probably null
R2944:Hfm1 UTSW 5 106872330 missense probably damaging 1.00
R3705:Hfm1 UTSW 5 106892839 unclassified probably benign
R4256:Hfm1 UTSW 5 106904797 missense possibly damaging 0.83
R4455:Hfm1 UTSW 5 106886508 splice site probably null
R4538:Hfm1 UTSW 5 106874890 missense possibly damaging 0.47
R4540:Hfm1 UTSW 5 106874221 nonsense probably null
R4745:Hfm1 UTSW 5 106901843 missense possibly damaging 0.87
R4747:Hfm1 UTSW 5 106917523 missense probably benign
R4765:Hfm1 UTSW 5 106842539 missense probably benign 0.21
R4821:Hfm1 UTSW 5 106854740 critical splice donor site probably null
R4842:Hfm1 UTSW 5 106892751 missense probably damaging 1.00
R4944:Hfm1 UTSW 5 106874213 missense possibly damaging 0.46
R5093:Hfm1 UTSW 5 106901731 missense probably damaging 1.00
R5399:Hfm1 UTSW 5 106917562 missense possibly damaging 0.91
R5414:Hfm1 UTSW 5 106902076 missense probably damaging 1.00
R5436:Hfm1 UTSW 5 106892772 missense possibly damaging 0.61
R5459:Hfm1 UTSW 5 106904763 missense probably damaging 1.00
R5485:Hfm1 UTSW 5 106847662 critical splice donor site probably null
R5585:Hfm1 UTSW 5 106911439 missense probably benign 0.05
R5631:Hfm1 UTSW 5 106904763 missense probably damaging 1.00
R5705:Hfm1 UTSW 5 106911453 missense probably benign 0.21
R5804:Hfm1 UTSW 5 106878589 splice site probably null
R5959:Hfm1 UTSW 5 106874917 missense probably damaging 1.00
R6046:Hfm1 UTSW 5 106898643 splice site probably null
R6191:Hfm1 UTSW 5 106886553 missense possibly damaging 0.95
R6345:Hfm1 UTSW 5 106841638 missense probably benign
R6580:Hfm1 UTSW 5 106847709 missense probably benign 0.00
R6651:Hfm1 UTSW 5 106847687 missense probably benign 0.00
R6761:Hfm1 UTSW 5 106895279 missense probably damaging 1.00
R6835:Hfm1 UTSW 5 106878815 nonsense probably null
R6891:Hfm1 UTSW 5 106917374 missense possibly damaging 0.49
R6924:Hfm1 UTSW 5 106850410 splice site probably null
R6980:Hfm1 UTSW 5 106880477 missense probably benign 0.31
R7054:Hfm1 UTSW 5 106896043 missense probably benign 0.01
R7058:Hfm1 UTSW 5 106911440 missense probably benign 0.04
R7189:Hfm1 UTSW 5 106901703 critical splice donor site probably null
R7250:Hfm1 UTSW 5 106904331 missense probably benign 0.00
R7376:Hfm1 UTSW 5 106895218 missense possibly damaging 0.95
R7577:Hfm1 UTSW 5 106896043 missense probably benign 0.01
R7636:Hfm1 UTSW 5 106917466 missense probably benign 0.02
R7639:Hfm1 UTSW 5 106889925 missense probably benign 0.03
R7639:Hfm1 UTSW 5 106898475 missense possibly damaging 0.46
R7763:Hfm1 UTSW 5 106881861 missense probably damaging 1.00
R7828:Hfm1 UTSW 5 106881791 critical splice donor site probably null
R7905:Hfm1 UTSW 5 106898553 missense probably damaging 1.00
R8160:Hfm1 UTSW 5 106896033 missense probably null 0.00
R8477:Hfm1 UTSW 5 106881818 missense probably benign 0.01
R8739:Hfm1 UTSW 5 106898505 missense probably damaging 0.96
R8968:Hfm1 UTSW 5 106917573 missense probably benign 0.00
R9072:Hfm1 UTSW 5 106898280 missense probably benign 0.04
R9073:Hfm1 UTSW 5 106898280 missense probably benign 0.04
R9152:Hfm1 UTSW 5 106841745 missense probably benign 0.01
R9234:Hfm1 UTSW 5 106893468 missense probably benign
R9244:Hfm1 UTSW 5 106874900 missense probably damaging 0.96
R9576:Hfm1 UTSW 5 106874072 missense probably benign 0.00
R9649:Hfm1 UTSW 5 106918463 missense possibly damaging 0.82
R9743:Hfm1 UTSW 5 106874259 missense possibly damaging 0.55
R9782:Hfm1 UTSW 5 106874030 missense probably benign 0.38
R9789:Hfm1 UTSW 5 106917480 missense probably benign 0.00
Z1177:Hfm1 UTSW 5 106871820 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAGGGAAAATGCTCTTTGTGG -3'
(R):5'- AAACGGTGATGTTCAGCAGGC -3'

Sequencing Primer
(F):5'- GGAAAATGCTCTTTGTGGAAAAG -3'
(R):5'- GGCATGCTAATATACCTGGAAAC -3'
Posted On 2015-09-24