Incidental Mutation 'R4591:Abca15'
ID342828
Institutional Source Beutler Lab
Gene Symbol Abca15
Ensembl Gene ENSMUSG00000054746
Gene NameATP-binding cassette, sub-family A (ABC1), member 15
Synonyms4930500I12Rik
Accession Numbers

NCBI RefSeq: NM_177213.3; MGI:2388709

Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R4591 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location120328670-120407687 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 120382413 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 1030 (D1030V)
Ref Sequence ENSEMBL: ENSMUSP00000112821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076272] [ENSMUST00000121265]
Predicted Effect probably damaging
Transcript: ENSMUST00000076272
AA Change: D1030V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075621
Gene: ENSMUSG00000054746
AA Change: D1030V

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 464 5.7e-21 PFAM
AAA 550 732 9.14e-11 SMART
Pfam:ABC2_membrane_3 892 1293 7.9e-24 PFAM
AAA 1381 1565 1.16e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121265
AA Change: D1030V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112821
Gene: ENSMUSG00000054746
AA Change: D1030V

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 24 464 2.1e-21 PFAM
AAA 550 732 9.14e-11 SMART
Pfam:ABC2_membrane_3 907 1293 1e-25 PFAM
AAA 1381 1565 1.16e-3 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted(2

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T C 3: 68,870,266 S187P possibly damaging Het
4932438H23Rik T C 16: 91,056,071 N59S probably damaging Het
Acmsd A T 1: 127,749,197 N153I probably damaging Het
Adprh C A 16: 38,445,983 V266L probably benign Het
Aldh5a1 G A 13: 24,924,008 P217S probably damaging Het
Alpk2 A T 18: 65,305,823 L1300Q probably benign Het
Alyref C T 11: 120,595,973 R154Q probably benign Het
Ano6 T A 15: 95,943,427 C468* probably null Het
Aox3 A T 1: 58,152,656 I456F probably damaging Het
Art4 A G 6: 136,854,757 Y129H probably damaging Het
Asb16 C A 11: 102,276,725 H306N probably damaging Het
Atp8a2 C A 14: 59,654,629 R1090L probably benign Het
Brap G T 5: 121,662,050 V1F probably null Het
C1qb C A 4: 136,882,217 G31W probably damaging Het
Cacna2d4 T C 6: 119,298,464 Y666H probably benign Het
Casr T C 16: 36,500,370 N472S probably benign Het
Ccdc91 T G 6: 147,590,465 S282A unknown Het
Cd300lg A G 11: 102,046,180 T164A probably benign Het
Cd79b A T 11: 106,312,046 D243E probably damaging Het
Cdh6 C A 15: 13,051,486 V354F possibly damaging Het
Cdhr2 A G 13: 54,715,684 N126S probably benign Het
Cep192 A T 18: 67,834,968 N841I probably damaging Het
Cngb1 T C 8: 95,253,384 T963A probably damaging Het
Col16a1 A G 4: 130,061,799 probably null Het
Coro1a A G 7: 126,702,992 V61A probably damaging Het
Crocc T A 4: 141,018,672 D1712V probably damaging Het
Ddn T C 15: 98,807,806 D3G possibly damaging Het
Dnal1 T C 12: 84,133,853 F89S probably benign Het
Dusp3 T A 11: 101,973,620 probably benign Het
Dyrk3 C A 1: 131,130,158 G58C probably damaging Het
Fat1 T C 8: 45,026,242 F2775S probably benign Het
Frk A G 10: 34,605,833 N373S probably benign Het
Glmn A G 5: 107,561,051 probably null Het
Gm11565 A T 11: 99,914,943 T54S possibly damaging Het
Gm14410 A G 2: 177,194,027 I148T possibly damaging Het
Gm21834 T A 17: 57,741,885 H112L possibly damaging Het
Gm5862 A G 5: 26,019,488 I161T possibly damaging Het
Grid2 G T 6: 64,320,102 G483V probably damaging Het
Hfm1 A T 5: 106,847,667 S1293T probably benign Het
Il1a G A 2: 129,306,527 R88W probably damaging Het
Il20rb A T 9: 100,474,990 V29D possibly damaging Het
Ilvbl C T 10: 78,583,305 L463F probably benign Het
Kif17 A G 4: 138,277,799 E225G probably benign Het
Lrp2 A G 2: 69,536,075 F227L probably damaging Het
Lrrc43 A G 5: 123,501,164 M419V probably benign Het
Magel2 A G 7: 62,381,089 Q1247R unknown Het
Mamdc4 T A 2: 25,564,597 M1068L possibly damaging Het
Marc1 T C 1: 184,807,168 E102G probably benign Het
Mdn1 T G 4: 32,707,636 S1642A probably damaging Het
Mtcl1 T C 17: 66,348,511 E819G probably benign Het
Naa15 T C 3: 51,441,924 L38P probably damaging Het
Nlrp3 A G 11: 59,549,222 R542G probably benign Het
Olfr1456-ps1 ACAC ACACGCAC 19: 13,078,902 noncoding transcript Het
Olfr201 A C 16: 59,269,413 F85V possibly damaging Het
Olfr462 A G 11: 87,889,549 S116P probably benign Het
Olfr95 C T 17: 37,211,119 V245I probably benign Het
Pbxip1 T A 3: 89,446,160 L249Q probably benign Het
Pla2g7 T C 17: 43,600,559 S201P probably damaging Het
Psmd1 G T 1: 86,128,204 V763F probably benign Het
Ptp4a2 A G 4: 129,846,515 E124G probably benign Het
Rab6b T C 9: 103,167,174 probably null Het
Rbks T A 5: 31,660,008 K139M possibly damaging Het
Rgs22 T A 15: 36,100,136 E268D probably benign Het
Slc16a9 T G 10: 70,282,880 L343R probably damaging Het
Smagp T C 15: 100,621,979 I55V probably damaging Het
Sox13 T C 1: 133,383,683 S604G probably damaging Het
St6gal1 G T 16: 23,321,294 V72F probably benign Het
Stxbp4 A G 11: 90,594,780 V247A probably benign Het
Susd3 A T 13: 49,231,260 M217K possibly damaging Het
Tas2r129 T A 6: 132,951,611 N170K probably benign Het
Tmem245 C A 4: 56,910,204 A515S probably damaging Het
Tpte T C 8: 22,327,775 V259A probably benign Het
Trpa1 T C 1: 14,882,108 probably null Het
Ttc28 G A 5: 111,223,281 R532H probably damaging Het
Vwa5a A T 9: 38,735,620 N529I possibly damaging Het
Zfp574 T C 7: 25,079,544 probably benign Het
Other mutations in Abca15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Abca15 APN 7 120397054 missense probably damaging 1.00
IGL00505:Abca15 APN 7 120369236 critical splice donor site probably null
IGL00851:Abca15 APN 7 120340007 missense probably damaging 1.00
IGL00985:Abca15 APN 7 120397018 missense probably damaging 1.00
IGL01114:Abca15 APN 7 120361420 missense probably damaging 0.99
IGL01287:Abca15 APN 7 120332858 utr 3 prime probably benign
IGL01333:Abca15 APN 7 120382308 missense probably damaging 1.00
IGL01482:Abca15 APN 7 120382746 missense probably benign 0.00
IGL01610:Abca15 APN 7 120340644 missense probably damaging 0.98
IGL02238:Abca15 APN 7 120396606 missense probably benign 0.02
IGL02377:Abca15 APN 7 120365910 splice site probably benign
IGL02666:Abca15 APN 7 120335208 missense probably damaging 1.00
IGL02836:Abca15 APN 7 120388216 missense probably benign
IGL03337:Abca15 APN 7 120396707 missense probably benign 0.24
IGL03354:Abca15 APN 7 120394488 nonsense probably null
H8562:Abca15 UTSW 7 120374854 splice site probably benign
IGL03098:Abca15 UTSW 7 120388276 splice site probably null
R0029:Abca15 UTSW 7 120346002 missense probably benign 0.01
R0029:Abca15 UTSW 7 120346002 missense probably benign 0.01
R0076:Abca15 UTSW 7 120373685 splice site probably benign
R0165:Abca15 UTSW 7 120350903 splice site probably benign
R0311:Abca15 UTSW 7 120402904 missense probably damaging 0.98
R0387:Abca15 UTSW 7 120332852 critical splice donor site probably null
R0610:Abca15 UTSW 7 120365786 missense possibly damaging 0.75
R0612:Abca15 UTSW 7 120337255 missense probably damaging 1.00
R0704:Abca15 UTSW 7 120354523 missense probably damaging 0.98
R0890:Abca15 UTSW 7 120373713 missense probably benign 0.01
R0961:Abca15 UTSW 7 120360985 nonsense probably null
R1144:Abca15 UTSW 7 120360860 splice site probably benign
R1412:Abca15 UTSW 7 120345323 missense possibly damaging 0.93
R1419:Abca15 UTSW 7 120374902 missense probably benign 0.10
R1467:Abca15 UTSW 7 120340538 splice site probably null
R1467:Abca15 UTSW 7 120340538 splice site probably null
R1469:Abca15 UTSW 7 120382497 missense probably benign 0.00
R1469:Abca15 UTSW 7 120382497 missense probably benign 0.00
R1493:Abca15 UTSW 7 120382290 missense probably benign 0.00
R1513:Abca15 UTSW 7 120340099 missense probably damaging 0.96
R1702:Abca15 UTSW 7 120382702 missense probably benign 0.10
R1857:Abca15 UTSW 7 120361369 missense probably damaging 1.00
R1893:Abca15 UTSW 7 120340553 missense possibly damaging 0.85
R1901:Abca15 UTSW 7 120346099 missense probably damaging 1.00
R1951:Abca15 UTSW 7 120361432 missense probably damaging 1.00
R1953:Abca15 UTSW 7 120361432 missense probably damaging 1.00
R1962:Abca15 UTSW 7 120341245 missense probably damaging 1.00
R2063:Abca15 UTSW 7 120360904 missense possibly damaging 0.61
R2141:Abca15 UTSW 7 120407474 missense probably damaging 1.00
R2145:Abca15 UTSW 7 120354478 missense probably benign 0.08
R2182:Abca15 UTSW 7 120340227 nonsense probably null
R2425:Abca15 UTSW 7 120359810 missense probably damaging 1.00
R2444:Abca15 UTSW 7 120365897 missense probably damaging 1.00
R3023:Abca15 UTSW 7 120382779 missense probably benign 0.40
R3079:Abca15 UTSW 7 120385169 missense probably damaging 1.00
R3106:Abca15 UTSW 7 120396633 missense possibly damaging 0.63
R3622:Abca15 UTSW 7 120350813 nonsense probably null
R4085:Abca15 UTSW 7 120382726 missense probably damaging 1.00
R4233:Abca15 UTSW 7 120402979 nonsense probably null
R4612:Abca15 UTSW 7 120335161 missense probably benign 0.03
R4721:Abca15 UTSW 7 120350775 missense probably benign 0.01
R4838:Abca15 UTSW 7 120345300 missense probably benign 0.00
R4940:Abca15 UTSW 7 120332694 missense probably benign
R4963:Abca15 UTSW 7 120360919 missense probably damaging 1.00
R4993:Abca15 UTSW 7 120401718 missense probably damaging 0.99
R5022:Abca15 UTSW 7 120346096 missense probably damaging 0.98
R5030:Abca15 UTSW 7 120340001 missense probably damaging 1.00
R5072:Abca15 UTSW 7 120406975 missense probably damaging 1.00
R5090:Abca15 UTSW 7 120385199 missense probably damaging 1.00
R5309:Abca15 UTSW 7 120345369 missense probably damaging 0.96
R5310:Abca15 UTSW 7 120332616 missense possibly damaging 0.46
R5312:Abca15 UTSW 7 120345369 missense probably damaging 0.96
R5482:Abca15 UTSW 7 120369147 missense probably damaging 1.00
R5596:Abca15 UTSW 7 120401749 missense possibly damaging 0.94
R5853:Abca15 UTSW 7 120340583 missense probably benign 0.00
R5950:Abca15 UTSW 7 120382656 missense probably damaging 1.00
R5953:Abca15 UTSW 7 120361018 missense probably damaging 1.00
R6072:Abca15 UTSW 7 120388258 missense probably damaging 0.98
R6131:Abca15 UTSW 7 120340205 missense probably benign 0.03
R6132:Abca15 UTSW 7 120361420 missense probably benign 0.14
R6136:Abca15 UTSW 7 120340049 missense possibly damaging 0.81
R6207:Abca15 UTSW 7 120373794 missense probably benign 0.01
R6315:Abca15 UTSW 7 120346092 missense probably damaging 1.00
R6417:Abca15 UTSW 7 120397128 missense possibly damaging 0.95
R6420:Abca15 UTSW 7 120397128 missense possibly damaging 0.95
R6595:Abca15 UTSW 7 120394487 missense probably benign 0.00
R6653:Abca15 UTSW 7 120346006 missense probably benign 0.03
R6859:Abca15 UTSW 7 120402994 nonsense probably null
R6983:Abca15 UTSW 7 120354463 missense probably benign 0.26
R7127:Abca15 UTSW 7 120332602 missense probably benign 0.06
R7205:Abca15 UTSW 7 120394364 missense possibly damaging 0.89
R7336:Abca15 UTSW 7 120388233 missense possibly damaging 0.66
R7426:Abca15 UTSW 7 120345998 missense possibly damaging 0.88
R7745:Abca15 UTSW 7 120332217 missense probably damaging 1.00
R7751:Abca15 UTSW 7 120365821 missense possibly damaging 0.72
R7806:Abca15 UTSW 7 120332836 missense probably damaging 0.96
R8042:Abca15 UTSW 7 120403010 missense possibly damaging 0.95
R8098:Abca15 UTSW 7 120361396 missense probably benign 0.09
R8153:Abca15 UTSW 7 120400589 missense probably damaging 1.00
R8247:Abca15 UTSW 7 120337222 missense possibly damaging 0.83
R8259:Abca15 UTSW 7 120340199 missense probably benign 0.00
R8272:Abca15 UTSW 7 120407442 missense probably damaging 1.00
R8295:Abca15 UTSW 7 120374965 missense probably benign 0.00
RF018:Abca15 UTSW 7 120394460 missense possibly damaging 0.50
Z1176:Abca15 UTSW 7 120346026 missense probably benign 0.22
Z1176:Abca15 UTSW 7 120382505 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTCGTGAGCAGCATGTTAG -3'
(R):5'- GCCCAGCTGAATTTTGAAGG -3'

Sequencing Primer
(F):5'- CGTGAGCAGCATGTTAGATTTAC -3'
(R):5'- GAAGGCTACAATCTTCCCATCTG -3'
Posted On2015-09-24