Incidental Mutation 'R4591:Stxbp4'
ID342841
Institutional Source Beutler Lab
Gene Symbol Stxbp4
Ensembl Gene ENSMUSG00000020546
Gene Namesyntaxin binding protein 4
SynonymsSynip, 6030470M02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4591 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location90476492-90638084 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90594780 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 247 (V247A)
Ref Sequence ENSEMBL: ENSMUSP00000116191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020858] [ENSMUST00000107875] [ENSMUST00000143203]
Predicted Effect probably benign
Transcript: ENSMUST00000020858
AA Change: V247A

PolyPhen 2 Score 0.330 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000020858
Gene: ENSMUSG00000020546
AA Change: V247A

DomainStartEndE-ValueType
PDZ 29 109 6.13e-10 SMART
low complexity region 131 154 N/A INTRINSIC
coiled coil region 298 409 N/A INTRINSIC
low complexity region 504 522 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107875
SMART Domains Protein: ENSMUSP00000103507
Gene: ENSMUSG00000020546

DomainStartEndE-ValueType
PDZ 29 109 6.13e-10 SMART
low complexity region 131 154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143203
AA Change: V247A

PolyPhen 2 Score 0.330 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000116191
Gene: ENSMUSG00000020546
AA Change: V247A

DomainStartEndE-ValueType
PDZ 29 109 6.13e-10 SMART
low complexity region 131 154 N/A INTRINSIC
coiled coil region 298 409 N/A INTRINSIC
WW 501 533 1.11e-10 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T C 3: 68,870,266 S187P possibly damaging Het
4932438H23Rik T C 16: 91,056,071 N59S probably damaging Het
Abca15 A T 7: 120,382,413 D1030V probably damaging Het
Acmsd A T 1: 127,749,197 N153I probably damaging Het
Adprh C A 16: 38,445,983 V266L probably benign Het
Aldh5a1 G A 13: 24,924,008 P217S probably damaging Het
Alpk2 A T 18: 65,305,823 L1300Q probably benign Het
Alyref C T 11: 120,595,973 R154Q probably benign Het
Ano6 T A 15: 95,943,427 C468* probably null Het
Aox3 A T 1: 58,152,656 I456F probably damaging Het
Art4 A G 6: 136,854,757 Y129H probably damaging Het
Asb16 C A 11: 102,276,725 H306N probably damaging Het
Atp8a2 C A 14: 59,654,629 R1090L probably benign Het
Brap G T 5: 121,662,050 V1F probably null Het
C1qb C A 4: 136,882,217 G31W probably damaging Het
Cacna2d4 T C 6: 119,298,464 Y666H probably benign Het
Casr T C 16: 36,500,370 N472S probably benign Het
Ccdc91 T G 6: 147,590,465 S282A unknown Het
Cd300lg A G 11: 102,046,180 T164A probably benign Het
Cd79b A T 11: 106,312,046 D243E probably damaging Het
Cdh6 C A 15: 13,051,486 V354F possibly damaging Het
Cdhr2 A G 13: 54,715,684 N126S probably benign Het
Cep192 A T 18: 67,834,968 N841I probably damaging Het
Cngb1 T C 8: 95,253,384 T963A probably damaging Het
Col16a1 A G 4: 130,061,799 probably null Het
Coro1a A G 7: 126,702,992 V61A probably damaging Het
Crocc T A 4: 141,018,672 D1712V probably damaging Het
Ddn T C 15: 98,807,806 D3G possibly damaging Het
Dnal1 T C 12: 84,133,853 F89S probably benign Het
Dusp3 T A 11: 101,973,620 probably benign Het
Dyrk3 C A 1: 131,130,158 G58C probably damaging Het
Fat1 T C 8: 45,026,242 F2775S probably benign Het
Frk A G 10: 34,605,833 N373S probably benign Het
Glmn A G 5: 107,561,051 probably null Het
Gm11565 A T 11: 99,914,943 T54S possibly damaging Het
Gm14410 A G 2: 177,194,027 I148T possibly damaging Het
Gm21834 T A 17: 57,741,885 H112L possibly damaging Het
Gm5862 A G 5: 26,019,488 I161T possibly damaging Het
Grid2 G T 6: 64,320,102 G483V probably damaging Het
Hfm1 A T 5: 106,847,667 S1293T probably benign Het
Il1a G A 2: 129,306,527 R88W probably damaging Het
Il20rb A T 9: 100,474,990 V29D possibly damaging Het
Ilvbl C T 10: 78,583,305 L463F probably benign Het
Kif17 A G 4: 138,277,799 E225G probably benign Het
Lrp2 A G 2: 69,536,075 F227L probably damaging Het
Lrrc43 A G 5: 123,501,164 M419V probably benign Het
Magel2 A G 7: 62,381,089 Q1247R unknown Het
Mamdc4 T A 2: 25,564,597 M1068L possibly damaging Het
Marc1 T C 1: 184,807,168 E102G probably benign Het
Mdn1 T G 4: 32,707,636 S1642A probably damaging Het
Mtcl1 T C 17: 66,348,511 E819G probably benign Het
Naa15 T C 3: 51,441,924 L38P probably damaging Het
Nlrp3 A G 11: 59,549,222 R542G probably benign Het
Olfr1456-ps1 ACAC ACACGCAC 19: 13,078,902 noncoding transcript Het
Olfr201 A C 16: 59,269,413 F85V possibly damaging Het
Olfr462 A G 11: 87,889,549 S116P probably benign Het
Olfr95 C T 17: 37,211,119 V245I probably benign Het
Pbxip1 T A 3: 89,446,160 L249Q probably benign Het
Pla2g7 T C 17: 43,600,559 S201P probably damaging Het
Psmd1 G T 1: 86,128,204 V763F probably benign Het
Ptp4a2 A G 4: 129,846,515 E124G probably benign Het
Rab6b T C 9: 103,167,174 probably null Het
Rbks T A 5: 31,660,008 K139M possibly damaging Het
Rgs22 T A 15: 36,100,136 E268D probably benign Het
Slc16a9 T G 10: 70,282,880 L343R probably damaging Het
Smagp T C 15: 100,621,979 I55V probably damaging Het
Sox13 T C 1: 133,383,683 S604G probably damaging Het
St6gal1 G T 16: 23,321,294 V72F probably benign Het
Susd3 A T 13: 49,231,260 M217K possibly damaging Het
Tas2r129 T A 6: 132,951,611 N170K probably benign Het
Tmem245 C A 4: 56,910,204 A515S probably damaging Het
Tpte T C 8: 22,327,775 V259A probably benign Het
Trpa1 T C 1: 14,882,108 probably null Het
Ttc28 G A 5: 111,223,281 R532H probably damaging Het
Vwa5a A T 9: 38,735,620 N529I possibly damaging Het
Zfp574 T C 7: 25,079,544 probably benign Het
Other mutations in Stxbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Stxbp4 APN 11 90535512 missense probably benign 0.00
IGL01312:Stxbp4 APN 11 90621649 splice site probably benign
IGL01313:Stxbp4 APN 11 90621649 splice site probably benign
IGL01314:Stxbp4 APN 11 90621649 splice site probably benign
IGL01316:Stxbp4 APN 11 90621649 splice site probably benign
IGL01377:Stxbp4 APN 11 90621649 splice site probably benign
IGL01380:Stxbp4 APN 11 90621649 splice site probably benign
IGL01385:Stxbp4 APN 11 90540248 missense possibly damaging 0.95
IGL01408:Stxbp4 APN 11 90621649 splice site probably benign
IGL02573:Stxbp4 APN 11 90540269 missense probably damaging 0.99
IGL02707:Stxbp4 APN 11 90537933 missense probably benign 0.00
IGL02809:Stxbp4 APN 11 90600184 critical splice donor site probably null
IGL02900:Stxbp4 APN 11 90607035 missense probably benign 0.03
IGL03177:Stxbp4 APN 11 90571753 missense probably benign 0.01
IGL03397:Stxbp4 APN 11 90540234 missense probably damaging 1.00
IGL02799:Stxbp4 UTSW 11 90494600 critical splice donor site probably null
IGL03134:Stxbp4 UTSW 11 90607184 missense probably damaging 0.98
R0005:Stxbp4 UTSW 11 90548917 missense possibly damaging 0.78
R0487:Stxbp4 UTSW 11 90592360 missense probably benign 0.00
R0930:Stxbp4 UTSW 11 90621700 start codon destroyed probably null 0.99
R1633:Stxbp4 UTSW 11 90540160 splice site probably benign
R3785:Stxbp4 UTSW 11 90535615 critical splice acceptor site probably null
R4359:Stxbp4 UTSW 11 90494644 nonsense probably null
R4756:Stxbp4 UTSW 11 90607371 missense probably damaging 1.00
R5095:Stxbp4 UTSW 11 90548975 missense probably benign 0.00
R5870:Stxbp4 UTSW 11 90537956 missense possibly damaging 0.89
R6268:Stxbp4 UTSW 11 90540201 nonsense probably null
R6460:Stxbp4 UTSW 11 90606985 missense probably benign 0.35
R6479:Stxbp4 UTSW 11 90619187 missense probably damaging 0.99
R7139:Stxbp4 UTSW 11 90607009 nonsense probably null
R7349:Stxbp4 UTSW 11 90592111 splice site probably null
R7481:Stxbp4 UTSW 11 90594813 missense possibly damaging 0.94
R7812:Stxbp4 UTSW 11 90594828 missense probably damaging 1.00
R8903:Stxbp4 UTSW 11 90535441 missense unknown
V8831:Stxbp4 UTSW 11 90480671 missense probably benign 0.34
Z1176:Stxbp4 UTSW 11 90480671 missense probably benign 0.34
Z1177:Stxbp4 UTSW 11 90480671 missense probably benign 0.34
Z1177:Stxbp4 UTSW 11 90592331 critical splice donor site probably null
Z1177:Stxbp4 UTSW 11 90600146 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGGTAGTGACTGACAATGGC -3'
(R):5'- TCAAGAGACTTTGCACGGATTC -3'

Sequencing Primer
(F):5'- GTGACTGACAATGGCCATTTTTAAAG -3'
(R):5'- CACGGATTCTAATTCTGGTCACGG -3'
Posted On2015-09-24