Incidental Mutation 'R4591:Cep192'
ID342871
Institutional Source Beutler Lab
Gene Symbol Cep192
Ensembl Gene ENSMUSG00000024542
Gene Namecentrosomal protein 192
Synonyms4631422C13Rik, D430014P18Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4591 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location67800107-67885170 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67834968 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 841 (N841I)
Ref Sequence ENSEMBL: ENSMUSP00000025425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025425]
Predicted Effect probably damaging
Transcript: ENSMUST00000025425
AA Change: N841I

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025425
Gene: ENSMUSG00000024542
AA Change: N841I

DomainStartEndE-ValueType
low complexity region 70 84 N/A INTRINSIC
low complexity region 195 217 N/A INTRINSIC
low complexity region 975 991 N/A INTRINSIC
low complexity region 1189 1204 N/A INTRINSIC
low complexity region 2051 2069 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225077
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T C 3: 68,870,266 S187P possibly damaging Het
4932438H23Rik T C 16: 91,056,071 N59S probably damaging Het
Abca15 A T 7: 120,382,413 D1030V probably damaging Het
Acmsd A T 1: 127,749,197 N153I probably damaging Het
Adprh C A 16: 38,445,983 V266L probably benign Het
Aldh5a1 G A 13: 24,924,008 P217S probably damaging Het
Alpk2 A T 18: 65,305,823 L1300Q probably benign Het
Alyref C T 11: 120,595,973 R154Q probably benign Het
Ano6 T A 15: 95,943,427 C468* probably null Het
Aox3 A T 1: 58,152,656 I456F probably damaging Het
Art4 A G 6: 136,854,757 Y129H probably damaging Het
Asb16 C A 11: 102,276,725 H306N probably damaging Het
Atp8a2 C A 14: 59,654,629 R1090L probably benign Het
Brap G T 5: 121,662,050 V1F probably null Het
C1qb C A 4: 136,882,217 G31W probably damaging Het
Cacna2d4 T C 6: 119,298,464 Y666H probably benign Het
Casr T C 16: 36,500,370 N472S probably benign Het
Ccdc91 T G 6: 147,590,465 S282A unknown Het
Cd300lg A G 11: 102,046,180 T164A probably benign Het
Cd79b A T 11: 106,312,046 D243E probably damaging Het
Cdh6 C A 15: 13,051,486 V354F possibly damaging Het
Cdhr2 A G 13: 54,715,684 N126S probably benign Het
Cngb1 T C 8: 95,253,384 T963A probably damaging Het
Col16a1 A G 4: 130,061,799 probably null Het
Coro1a A G 7: 126,702,992 V61A probably damaging Het
Crocc T A 4: 141,018,672 D1712V probably damaging Het
Ddn T C 15: 98,807,806 D3G possibly damaging Het
Dnal1 T C 12: 84,133,853 F89S probably benign Het
Dusp3 T A 11: 101,973,620 probably benign Het
Dyrk3 C A 1: 131,130,158 G58C probably damaging Het
Fat1 T C 8: 45,026,242 F2775S probably benign Het
Frk A G 10: 34,605,833 N373S probably benign Het
Glmn A G 5: 107,561,051 probably null Het
Gm11565 A T 11: 99,914,943 T54S possibly damaging Het
Gm14410 A G 2: 177,194,027 I148T possibly damaging Het
Gm21834 T A 17: 57,741,885 H112L possibly damaging Het
Gm5862 A G 5: 26,019,488 I161T possibly damaging Het
Grid2 G T 6: 64,320,102 G483V probably damaging Het
Hfm1 A T 5: 106,847,667 S1293T probably benign Het
Il1a G A 2: 129,306,527 R88W probably damaging Het
Il20rb A T 9: 100,474,990 V29D possibly damaging Het
Ilvbl C T 10: 78,583,305 L463F probably benign Het
Kif17 A G 4: 138,277,799 E225G probably benign Het
Lrp2 A G 2: 69,536,075 F227L probably damaging Het
Lrrc43 A G 5: 123,501,164 M419V probably benign Het
Magel2 A G 7: 62,381,089 Q1247R unknown Het
Mamdc4 T A 2: 25,564,597 M1068L possibly damaging Het
Marc1 T C 1: 184,807,168 E102G probably benign Het
Mdn1 T G 4: 32,707,636 S1642A probably damaging Het
Mtcl1 T C 17: 66,348,511 E819G probably benign Het
Naa15 T C 3: 51,441,924 L38P probably damaging Het
Nlrp3 A G 11: 59,549,222 R542G probably benign Het
Olfr1456-ps1 ACAC ACACGCAC 19: 13,078,902 noncoding transcript Het
Olfr201 A C 16: 59,269,413 F85V possibly damaging Het
Olfr462 A G 11: 87,889,549 S116P probably benign Het
Olfr95 C T 17: 37,211,119 V245I probably benign Het
Pbxip1 T A 3: 89,446,160 L249Q probably benign Het
Pla2g7 T C 17: 43,600,559 S201P probably damaging Het
Psmd1 G T 1: 86,128,204 V763F probably benign Het
Ptp4a2 A G 4: 129,846,515 E124G probably benign Het
Rab6b T C 9: 103,167,174 probably null Het
Rbks T A 5: 31,660,008 K139M possibly damaging Het
Rgs22 T A 15: 36,100,136 E268D probably benign Het
Slc16a9 T G 10: 70,282,880 L343R probably damaging Het
Smagp T C 15: 100,621,979 I55V probably damaging Het
Sox13 T C 1: 133,383,683 S604G probably damaging Het
St6gal1 G T 16: 23,321,294 V72F probably benign Het
Stxbp4 A G 11: 90,594,780 V247A probably benign Het
Susd3 A T 13: 49,231,260 M217K possibly damaging Het
Tas2r129 T A 6: 132,951,611 N170K probably benign Het
Tmem245 C A 4: 56,910,204 A515S probably damaging Het
Tpte T C 8: 22,327,775 V259A probably benign Het
Trpa1 T C 1: 14,882,108 probably null Het
Ttc28 G A 5: 111,223,281 R532H probably damaging Het
Vwa5a A T 9: 38,735,620 N529I possibly damaging Het
Zfp574 T C 7: 25,079,544 probably benign Het
Other mutations in Cep192
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Cep192 APN 18 67820336 missense probably damaging 1.00
IGL00163:Cep192 APN 18 67880800 missense possibly damaging 0.61
IGL00509:Cep192 APN 18 67858868 missense possibly damaging 0.78
IGL01012:Cep192 APN 18 67812406 missense possibly damaging 0.95
IGL01143:Cep192 APN 18 67804375 missense probably damaging 0.97
IGL01302:Cep192 APN 18 67858903 missense probably benign 0.03
IGL01653:Cep192 APN 18 67852972 missense possibly damaging 0.57
IGL02202:Cep192 APN 18 67803137 missense possibly damaging 0.83
IGL02448:Cep192 APN 18 67869447 missense probably benign 0.25
IGL02494:Cep192 APN 18 67804383 missense probably benign 0.00
IGL02574:Cep192 APN 18 67841279 missense probably damaging 0.99
IGL02624:Cep192 APN 18 67880795 missense probably benign 0.20
IGL02646:Cep192 APN 18 67862477 missense probably damaging 1.00
IGL02652:Cep192 APN 18 67858850 splice site probably benign
IGL02684:Cep192 APN 18 67834563 missense probably damaging 0.99
IGL02977:Cep192 APN 18 67852905 missense probably damaging 0.97
IGL03000:Cep192 APN 18 67852044 missense probably damaging 1.00
IGL03133:Cep192 APN 18 67810105 missense probably benign 0.00
IGL03139:Cep192 APN 18 67828476 critical splice donor site probably null
IGL03213:Cep192 APN 18 67865637 missense probably damaging 1.00
IGL03250:Cep192 APN 18 67807355 missense probably benign 0.01
IGL03259:Cep192 APN 18 67820412 missense probably damaging 1.00
R0117:Cep192 UTSW 18 67850737 critical splice donor site probably null
R0180:Cep192 UTSW 18 67835488 missense probably damaging 1.00
R0281:Cep192 UTSW 18 67828482 splice site probably benign
R0374:Cep192 UTSW 18 67818883 nonsense probably null
R0420:Cep192 UTSW 18 67813893 missense possibly damaging 0.91
R0479:Cep192 UTSW 18 67858018 missense probably damaging 1.00
R0652:Cep192 UTSW 18 67807265 missense probably benign 0.04
R1024:Cep192 UTSW 18 67838054 missense probably benign 0.37
R1382:Cep192 UTSW 18 67856299 missense possibly damaging 0.74
R1394:Cep192 UTSW 18 67858921 missense probably damaging 1.00
R1395:Cep192 UTSW 18 67858921 missense probably damaging 1.00
R1641:Cep192 UTSW 18 67847433 missense probably damaging 1.00
R1704:Cep192 UTSW 18 67856256 missense probably damaging 1.00
R1793:Cep192 UTSW 18 67851767 missense possibly damaging 0.74
R1835:Cep192 UTSW 18 67804424 missense possibly damaging 0.95
R1978:Cep192 UTSW 18 67803158 critical splice donor site probably null
R2164:Cep192 UTSW 18 67820360 missense probably damaging 0.99
R2180:Cep192 UTSW 18 67824742 missense possibly damaging 0.82
R2307:Cep192 UTSW 18 67813899 missense probably benign 0.07
R2442:Cep192 UTSW 18 67824688 missense possibly damaging 0.89
R2897:Cep192 UTSW 18 67855270 splice site probably null
R2898:Cep192 UTSW 18 67855270 splice site probably null
R2901:Cep192 UTSW 18 67869441 missense possibly damaging 0.94
R3433:Cep192 UTSW 18 67834892 missense probably benign 0.08
R3620:Cep192 UTSW 18 67829857 missense probably benign 0.00
R3621:Cep192 UTSW 18 67829857 missense probably benign 0.00
R3712:Cep192 UTSW 18 67820329 missense probably benign 0.00
R4559:Cep192 UTSW 18 67871513 missense probably damaging 1.00
R4590:Cep192 UTSW 18 67816791 nonsense probably null
R4604:Cep192 UTSW 18 67815922 missense possibly damaging 0.64
R4627:Cep192 UTSW 18 67812369 missense probably benign 0.03
R4725:Cep192 UTSW 18 67816766 missense probably benign
R4738:Cep192 UTSW 18 67884830 nonsense probably null
R4739:Cep192 UTSW 18 67851732 missense probably benign 0.02
R4927:Cep192 UTSW 18 67835124 missense probably benign 0.16
R4948:Cep192 UTSW 18 67816804 missense probably benign 0.00
R5090:Cep192 UTSW 18 67860546 missense possibly damaging 0.60
R5105:Cep192 UTSW 18 67866541 missense probably benign 0.08
R5154:Cep192 UTSW 18 67850684 missense probably damaging 1.00
R5192:Cep192 UTSW 18 67835004 missense probably benign 0.03
R5735:Cep192 UTSW 18 67880795 missense probably benign 0.20
R5812:Cep192 UTSW 18 67851737 missense possibly damaging 0.49
R5869:Cep192 UTSW 18 67815864 missense probably benign 0.01
R5981:Cep192 UTSW 18 67860590 missense probably damaging 1.00
R6131:Cep192 UTSW 18 67837997 missense possibly damaging 0.65
R6335:Cep192 UTSW 18 67834713 missense probably damaging 1.00
R6849:Cep192 UTSW 18 67812435 missense probably benign 0.00
R6861:Cep192 UTSW 18 67841628 missense probably benign 0.43
R7192:Cep192 UTSW 18 67850528 missense probably damaging 0.99
R7264:Cep192 UTSW 18 67820355 missense probably damaging 1.00
R7397:Cep192 UTSW 18 67856197 missense probably damaging 1.00
R7409:Cep192 UTSW 18 67834803 missense possibly damaging 0.76
R7696:Cep192 UTSW 18 67820363 missense probably damaging 1.00
R7756:Cep192 UTSW 18 67856313 missense possibly damaging 0.92
R7758:Cep192 UTSW 18 67856313 missense possibly damaging 0.92
RF003:Cep192 UTSW 18 67837956 missense probably benign 0.44
X0066:Cep192 UTSW 18 67812449 splice site probably null
Z1176:Cep192 UTSW 18 67881288 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGCTGTGAAGGTGCACGAG -3'
(R):5'- ACACTGTTCTACGATGCTAAAGGAAG -3'

Sequencing Primer
(F):5'- GAGAGCCCCTTTCAAGAGCAG -3'
(R):5'- AGTAGTGAGTCACTCCTGGAC -3'
Posted On2015-09-24