Mutagenetix > Incidental Mutations

Incidental Mutation 'R4592:Pax8'

342876

Institutional Source

Beutler Lab

Gene Symbol

Pax8

Ensembl Gene

ENSMUSG00000026976

Gene Name

paired box 8

Synonyms

Pax-8

MMRRC Submission

041808-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4592 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

24420560-24475599 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

T to A at 24443189 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000134343 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028355] [ENSMUST00000136228] [ENSMUST00000149294] [ENSMUST00000153535] [ENSMUST00000153601]

Predicted Effect

probably benign
Transcript: ENSMUST00000028355

SMART Domains

Protein: ENSMUSP00000028355
Gene: ENSMUSG00000026976

Domain	Start	End	E-Value	Type
PAX	9	133	3.1e-93	SMART
SCOP:d1ftt__	221	247	8e-5	SMART
low complexity region	311	328	N/A	INTRINSIC
Pfam:Pax2_C	344	456	2.3e-57	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131886

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133746

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135829

Predicted Effect

probably benign
Transcript: ENSMUST00000136228

SMART Domains

Protein: ENSMUSP00000133316
Gene: ENSMUSG00000026976

Domain	Start	End	E-Value	Type
PAX	9	134	9.13e-91	SMART
SCOP:d1fjla_	221	248	8e-5	SMART
low complexity region	312	329	N/A	INTRINSIC
Pfam:Pax2_C	342	404	1.2e-25	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000149294

SMART Domains

Protein: ENSMUSP00000115194
Gene: ENSMUSG00000026976

Domain	Start	End	E-Value	Type
PAX	9	133	3.1e-93	SMART
SCOP:d1ftt__	221	247	3e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000153535

SMART Domains

Protein: ENSMUSP00000120319
Gene: ENSMUSG00000026976

Domain	Start	End	E-Value	Type
PAX	9	134	9.13e-91	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000153601

SMART Domains

Protein: ENSMUSP00000134343
Gene: ENSMUSG00000026976

Domain	Start	End	E-Value	Type
SCOP:d1ftt__	23	49	1e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187034

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (64/65)

MGI Phenotype

FUNCTION: This gene encodes a member of a family of transcription factors that contain a characteristic N-terminal paired DNA-binding domain. The encoded protein is important for proper differentiation of the thyroid and the kidney. Alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygotes for targeted mutations exhibit severe hypothyroidism due to thyroid follicular cell aplasia, male infertility, deafness, ataxia, growth retardation, tiny spleens, impaired ossification of long bones and maturation of the small intestine, fatty livers, and lethality around weaning age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001P01Rik	A	G	11: 97,771,615	S144P	probably damaging	Het
4933430I17Rik	T	A	4: 62,538,927	V161E	possibly damaging	Het
Arhgap40	T	C	2: 158,546,709	V521A	possibly damaging	Het
Atrn	T	C	2: 130,999,130		probably benign	Het
Casp12	T	C	9: 5,352,923		probably benign	Het
Ccdc189	C	T	7: 127,585,491	R172H	probably benign	Het
Cenpf	G	A	1: 189,679,033	T318M	probably damaging	Het
Clcn2	T	C	16: 20,709,142	K525E	probably damaging	Het
Cntln	A	G	4: 84,971,182	T301A	probably benign	Het
Crat	T	C	2: 30,415,366		probably benign	Het
Cul5	A	G	9: 53,633,727		probably benign	Het
Cxcl14	A	T	13: 56,295,895	I34N	probably damaging	Het
Cyp2b19	A	G	7: 26,771,394	I487V	probably benign	Het
Cyp4a10	T	A	4: 115,529,493	F446I	probably damaging	Het
D430041D05Rik	T	A	2: 104,233,479	M659L	possibly damaging	Het
Dclk3	T	C	9: 111,467,895	F169S	probably damaging	Het
Ddx52	T	C	11: 83,957,480	I532T	probably damaging	Het
Dnm1	T	C	2: 32,336,011	D352G	probably damaging	Het
Eif4g2	T	C	7: 111,078,302	E174G	probably damaging	Het
Enpp6	G	T	8: 47,093,032	V386L	probably damaging	Het
Eps15l1	T	C	8: 72,341,394	D904G	probably damaging	Het
Esrrb	A	G	12: 86,518,830	Y356C	probably damaging	Het
Flt3	A	T	5: 147,354,699	S619T	possibly damaging	Het
Fndc7	A	T	3: 108,858,902	C716S	probably damaging	Het
Gm10125	T	C	18: 5,525,375		noncoding transcript	Het
Gm26996	T	A	6: 130,579,485		noncoding transcript	Het
Grik2	A	T	10: 49,422,615	F50I	possibly damaging	Het
Guf1	T	C	5: 69,566,443	V367A	possibly damaging	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Ifnar2	T	C	16: 91,391,796	V55A	probably benign	Het
Impg1	T	A	9: 80,440,854	I33F	probably benign	Het
Ltbp4	A	C	7: 27,325,183	V674G	probably damaging	Het
Mroh2b	T	A	15: 4,918,290	L529H	probably damaging	Het
Negr1	T	C	3: 157,208,386		probably benign	Het
Neurog3	A	G	10: 62,133,820	T25A	probably damaging	Het
Olfr1241	T	A	2: 89,482,756	K126N	probably damaging	Het
Olfr1420	T	C	19: 11,896,762	V247A	probably benign	Het
Olfr181	T	C	16: 58,926,092	T160A	probably benign	Het
Olfr555	A	C	7: 102,659,478	Y219S	probably damaging	Het
Pcsk6	A	C	7: 65,931,732	I254L	possibly damaging	Het
Pde3a	A	G	6: 141,459,216	K389R	probably benign	Het
Rab3gap1	C	A	1: 127,925,259		probably benign	Het
Rbck1	G	A	2: 152,318,733	Q428*	probably null	Het
Rptor	A	G	11: 119,798,840	D321G	probably null	Het
Sall2	C	A	14: 52,313,803	R643L	probably damaging	Het
Sdccag3	C	A	2: 26,388,897		probably benign	Het
Skp1a	T	C	11: 52,243,619	I59T	possibly damaging	Het
Slc23a3	T	G	1: 75,128,556	N456T	probably damaging	Het
Slc4a7	G	A	14: 14,778,850	G920S	probably damaging	Het
Smarcd3	T	C	5: 24,592,804	I467V	probably benign	Het
Spata31d1c	C	T	13: 65,036,060	A472V	probably damaging	Het
Srsf6	T	C	2: 162,931,723	I18T	probably damaging	Het
Stom	C	T	2: 35,323,746	G80D	probably damaging	Het
Svep1	A	T	4: 58,084,028	Y1915N	possibly damaging	Het
Tmf1	C	T	6: 97,173,400	V449I	probably benign	Het
Triobp	C	T	15: 78,967,095	A483V	probably benign	Het
Vdac1	G	A	11: 52,374,972		probably null	Het
Vmn2r75	T	G	7: 86,166,286	E123D	probably benign	Het
Vmn2r79	T	A	7: 87,004,111	V528D	possibly damaging	Het
Zdbf2	T	G	1: 63,306,591	N1376K	possibly damaging	Het

Other mutations in Pax8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Pax8	APN	2	24443132	missense	probably damaging	1.00
IGL01118:Pax8	APN	2	24442932	splice site	probably benign
IGL01141:Pax8	APN	2	24441150	missense	probably damaging	1.00
IGL01338:Pax8	APN	2	24435919	missense	possibly damaging	0.93
IGL01801:Pax8	APN	2	24444564	critical splice donor site	probably null
IGL02159:Pax8	APN	2	24440788	missense	possibly damaging	0.56
IGL02727:Pax8	APN	2	24441630	missense	probably damaging	0.98
IGL02887:Pax8	APN	2	24444615	missense	probably damaging	1.00
IGL03134:Pax8	UTSW	2	24421391	unclassified	probably benign
R1499:Pax8	UTSW	2	24429596	missense	possibly damaging	0.92
R1756:Pax8	UTSW	2	24435821	missense	probably damaging	0.98
R2051:Pax8	UTSW	2	24436508	missense	probably benign
R2234:Pax8	UTSW	2	24443102	missense	probably damaging	1.00
R2289:Pax8	UTSW	2	24440740	missense	probably benign	0.00
R2306:Pax8	UTSW	2	24443045	missense	probably damaging	1.00
R4328:Pax8	UTSW	2	24441651	missense	possibly damaging	0.92
R4434:Pax8	UTSW	2	24429609	missense	possibly damaging	0.93
R4610:Pax8	UTSW	2	24421583	missense	probably damaging	0.99
R4873:Pax8	UTSW	2	24441640	missense	probably benign	0.04
R4875:Pax8	UTSW	2	24441640	missense	probably benign	0.04
R5394:Pax8	UTSW	2	24442910	intron	probably benign
R5924:Pax8	UTSW	2	24421622	missense	probably damaging	0.97
R6796:Pax8	UTSW	2	24441086	missense	probably benign	0.04
R7658:Pax8	UTSW	2	24436511	missense	probably benign	0.00
R7660:Pax8	UTSW	2	24436561	missense	probably benign
R7690:Pax8	UTSW	2	24441670	missense	probably benign	0.37
R7775:Pax8	UTSW	2	24435901	missense	possibly damaging	0.93
R7793:Pax8	UTSW	2	24429597	missense	possibly damaging	0.85
R7824:Pax8	UTSW	2	24435901	missense	possibly damaging	0.93
R7859:Pax8	UTSW	2	24421555	missense	possibly damaging	0.93
R8225:Pax8	UTSW	2	24422971	missense	probably damaging	0.99
R8520:Pax8	UTSW	2	24443022	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGATCTCCCAAGCAAACATGG -3'
(R):5'- TTGTGGGCTTTCTGATGCAAATAC -3'

Sequencing Primer
(F):5'- CAAACATGGTAGGGTTCTGCC -3'
(R):5'- GCTTTCTGATGCAAATACAGCGAG -3'

Posted On

2015-09-24