Incidental Mutation 'R0346:Myh4'
ID34288
Institutional Source Beutler Lab
Gene Symbol Myh4
Ensembl Gene ENSMUSG00000057003
Gene Namemyosin, heavy polypeptide 4, skeletal muscle
SynonymsMM, Minimsc, MYH-2B, MyHC-IIb, Minmus, MHC2B, Myhsf
MMRRC Submission 038553-MU
Accession Numbers

Genbank: NM_010855; MGI: 1339713

Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R0346 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location67238029-67260446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 67260326 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 1936 (I1936L)
Ref Sequence ENSEMBL: ENSMUSP00000127514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018632] [ENSMUST00000170942]
Predicted Effect probably benign
Transcript: ENSMUST00000018632
AA Change: I1936L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000018632
Gene: ENSMUSG00000057003
AA Change: I1936L

DomainStartEndE-ValueType
Pfam:Myosin_N 35 74 4.7e-14 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 8.84e-3 SMART
Pfam:Myosin_tail_1 847 1928 2.5e-168 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170942
AA Change: I1936L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127514
Gene: ENSMUSG00000057003
AA Change: I1936L

DomainStartEndE-ValueType
Pfam:Myosin_N 35 76 1.1e-15 PFAM
MYSc 80 783 N/A SMART
IQ 784 806 8.84e-3 SMART
low complexity region 928 942 N/A INTRINSIC
Pfam:Myosin_tail_1 1072 1930 N/A PFAM
Meta Mutation Damage Score 0.0597 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.4%
Validation Efficiency 100% (79/79)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit decreased growth and muscle defects including reduced muscle mass, muscle fiber loss, compensatory fiber hypertrophy, and impaired strength. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Targeted, other(2)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,566,278 I4406L probably damaging Het
Abca16 T A 7: 120,435,932 C314S probably damaging Het
Add3 C T 19: 53,216,956 R46* probably null Het
Alas1 A T 9: 106,243,351 S82T possibly damaging Het
Alkbh5 C G 11: 60,538,741 R107G possibly damaging Het
Ap3b1 A T 13: 94,445,971 R365* probably null Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
AU021092 T C 16: 5,216,854 D168G possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Caln1 C A 5: 130,822,921 H184N possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Ccdc191 T C 16: 43,938,952 V372A probably damaging Het
Ccng2 T G 5: 93,270,894 I126S probably damaging Het
Cep85 A T 4: 134,132,422 N643K probably damaging Het
Clvs2 G C 10: 33,622,546 S129R possibly damaging Het
Cntn1 G T 15: 92,232,087 probably benign Het
Cttn A T 7: 144,452,539 probably benign Het
Dedd2 T C 7: 25,211,269 S161G possibly damaging Het
Dnajb13 T C 7: 100,503,925 D263G probably damaging Het
Dppa4 T A 16: 48,289,324 probably benign Het
Ear2 A G 14: 44,102,906 E7G probably damaging Het
Eif2b4 A G 5: 31,188,108 probably benign Het
Etl4 G T 2: 20,759,652 probably null Het
Fbxo15 T A 18: 84,960,221 probably null Het
Gm8765 T C 13: 50,703,310 Y995H probably benign Het
Gm9970 A G 5: 31,240,838 probably benign Het
Hap1 A G 11: 100,356,029 S17P probably benign Het
Hgd C T 16: 37,588,774 probably benign Het
Inpp5f T A 7: 128,690,668 L16Q probably damaging Het
Islr2 G A 9: 58,198,343 R545* probably null Het
Itgav G T 2: 83,792,609 C675F probably damaging Het
Kif13a T A 13: 46,814,219 I403L possibly damaging Het
Kif14 T A 1: 136,468,160 I68N probably damaging Het
Kif26a G T 12: 112,179,348 K1764N probably null Het
Lrrd1 C A 5: 3,850,215 F173L probably benign Het
Mroh4 G C 15: 74,614,292 probably benign Het
Mrvi1 T C 7: 110,898,976 D404G probably damaging Het
Msh5 A G 17: 35,029,888 V723A probably benign Het
Mybph T G 1: 134,197,754 I279S probably damaging Het
Myo1h A T 5: 114,355,209 T704S probably benign Het
Nav2 C A 7: 49,604,585 T2377K probably benign Het
Nipbl T G 15: 8,360,956 Q276H probably damaging Het
Nlrp9b T C 7: 20,024,515 L559P probably damaging Het
Nup210l T A 3: 90,189,438 V1318E probably damaging Het
Olfr1427 A T 19: 12,099,439 S67T probably damaging Het
Olfr18 A G 9: 20,314,411 S170P probably benign Het
Olfr385 A G 11: 73,589,457 Y94H probably damaging Het
Olfr765 C A 10: 129,046,473 V197F possibly damaging Het
P2ry13 T C 3: 59,209,566 T264A possibly damaging Het
Plekhg5 T C 4: 152,114,253 L966P probably benign Het
Prss35 A G 9: 86,755,351 K58R probably benign Het
Ptafr T A 4: 132,580,079 L260* probably null Het
Pum1 A T 4: 130,779,805 T1157S possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf145 A G 11: 44,555,164 Y275C probably damaging Het
Rpl6 A T 5: 121,208,491 K218N possibly damaging Het
Rps6 T C 4: 86,855,981 T128A probably benign Het
Ryr1 G T 7: 29,067,588 probably benign Het
Scel A T 14: 103,529,984 Q26H probably damaging Het
Sfxn4 A T 19: 60,858,673 D57E probably benign Het
Slc35d1 A C 4: 103,190,847 L240R probably damaging Het
Smcr8 A G 11: 60,779,750 I575V probably benign Het
Syk G A 13: 52,640,659 M476I probably damaging Het
Tbcel A T 9: 42,437,243 probably benign Het
Tob2 C A 15: 81,858,223 G65W probably damaging Het
Trim16 A G 11: 62,840,694 N464D probably benign Het
Trim36 T C 18: 46,199,709 probably benign Het
Trpv4 C A 5: 114,630,529 probably benign Het
Tsga10 T A 1: 37,840,519 T64S possibly damaging Het
Ttc26 T C 6: 38,409,435 C364R probably damaging Het
Vars2 A T 17: 35,664,864 probably benign Het
Vmn1r72 C A 7: 11,669,694 V276L probably benign Het
Vps13a T A 19: 16,677,969 K1898N probably benign Het
Vps18 A G 2: 119,297,164 M823V probably damaging Het
Washc2 T C 6: 116,220,523 probably benign Het
Zfp763 A T 17: 33,019,747 H141Q probably benign Het
Other mutations in Myh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01471:Myh4 APN 11 67255379 missense probably damaging 1.00
IGL01600:Myh4 APN 11 67260189 missense possibly damaging 0.85
IGL01737:Myh4 APN 11 67243419 splice site probably benign
IGL02208:Myh4 APN 11 67251934 missense possibly damaging 0.96
IGL02334:Myh4 APN 11 67245547 missense probably damaging 1.00
IGL02376:Myh4 APN 11 67245728 missense probably benign 0.00
IGL02429:Myh4 APN 11 67258982 nonsense probably null
IGL02450:Myh4 APN 11 67251809 missense probably damaging 1.00
IGL02524:Myh4 APN 11 67249240 missense possibly damaging 0.79
IGL02612:Myh4 APN 11 67256479 missense probably benign
IGL03024:Myh4 APN 11 67248479 missense probably damaging 1.00
IGL03065:Myh4 APN 11 67259156 missense probably benign 0.12
IGL03084:Myh4 APN 11 67251951 splice site probably null
IGL03188:Myh4 APN 11 67246543 critical splice donor site probably null
IGL03204:Myh4 APN 11 67250296 missense possibly damaging 0.63
IGL03252:Myh4 APN 11 67252216 missense probably damaging 0.99
IGL03345:Myh4 APN 11 67255478 missense probably damaging 1.00
F6893:Myh4 UTSW 11 67255457 missense probably null 0.12
PIT1430001:Myh4 UTSW 11 67258832 missense probably benign 0.01
PIT4458001:Myh4 UTSW 11 67240995 missense possibly damaging 0.56
R0099:Myh4 UTSW 11 67259347 missense probably benign
R0194:Myh4 UTSW 11 67252336 missense probably damaging 1.00
R0427:Myh4 UTSW 11 67258653 missense probably damaging 0.98
R0483:Myh4 UTSW 11 67252297 missense probably damaging 1.00
R0571:Myh4 UTSW 11 67250331 missense possibly damaging 0.91
R0854:Myh4 UTSW 11 67259147 missense possibly damaging 0.90
R0940:Myh4 UTSW 11 67242863 missense probably damaging 1.00
R0946:Myh4 UTSW 11 67251751 missense possibly damaging 0.70
R1108:Myh4 UTSW 11 67255706 missense probably null 0.01
R1162:Myh4 UTSW 11 67258613 missense probably damaging 0.97
R1194:Myh4 UTSW 11 67255734 critical splice donor site probably null
R1347:Myh4 UTSW 11 67244741 splice site probably benign
R1457:Myh4 UTSW 11 67248461 missense probably damaging 0.99
R1531:Myh4 UTSW 11 67250540 missense probably benign 0.01
R1716:Myh4 UTSW 11 67250309 missense possibly damaging 0.92
R1766:Myh4 UTSW 11 67256295 missense possibly damaging 0.61
R1796:Myh4 UTSW 11 67260324 missense probably benign
R1856:Myh4 UTSW 11 67255682 missense probably damaging 1.00
R1873:Myh4 UTSW 11 67254743 missense probably benign 0.16
R2069:Myh4 UTSW 11 67246366 splice site probably benign
R2370:Myh4 UTSW 11 67255628 missense probably damaging 1.00
R2406:Myh4 UTSW 11 67259174 missense probably damaging 1.00
R2414:Myh4 UTSW 11 67250768 missense probably benign 0.01
R2848:Myh4 UTSW 11 67248633 missense probably benign 0.20
R3111:Myh4 UTSW 11 67246450 missense possibly damaging 0.86
R3744:Myh4 UTSW 11 67255315 missense probably damaging 1.00
R3845:Myh4 UTSW 11 67259105 missense possibly damaging 0.90
R3877:Myh4 UTSW 11 67257183 missense probably benign 0.00
R4498:Myh4 UTSW 11 67251752 missense probably damaging 1.00
R4514:Myh4 UTSW 11 67255569 missense probably benign 0.06
R4601:Myh4 UTSW 11 67250310 missense possibly damaging 0.94
R4673:Myh4 UTSW 11 67246401 missense probably benign 0.02
R4684:Myh4 UTSW 11 67245811 missense probably damaging 0.99
R4736:Myh4 UTSW 11 67240920 missense probably benign 0.01
R4837:Myh4 UTSW 11 67258992 missense probably benign 0.38
R4866:Myh4 UTSW 11 67248627 missense probably benign 0.00
R4869:Myh4 UTSW 11 67252664 missense probably damaging 1.00
R4887:Myh4 UTSW 11 67241054 missense probably damaging 0.99
R4921:Myh4 UTSW 11 67254028 missense probably damaging 1.00
R5005:Myh4 UTSW 11 67253415 missense probably benign 0.05
R5008:Myh4 UTSW 11 67253532 missense probably benign 0.00
R5011:Myh4 UTSW 11 67256363 missense probably benign 0.03
R5087:Myh4 UTSW 11 67255409 missense probably damaging 1.00
R5277:Myh4 UTSW 11 67252354 missense probably damaging 1.00
R5336:Myh4 UTSW 11 67259191 splice site probably null
R5354:Myh4 UTSW 11 67255725 missense possibly damaging 0.69
R5371:Myh4 UTSW 11 67259324 missense probably damaging 1.00
R5484:Myh4 UTSW 11 67251818 missense probably damaging 1.00
R5774:Myh4 UTSW 11 67253208 nonsense probably null
R5902:Myh4 UTSW 11 67250907 missense possibly damaging 0.69
R5941:Myh4 UTSW 11 67259300 missense probably damaging 0.99
R6045:Myh4 UTSW 11 67244724 missense probably benign 0.32
R6156:Myh4 UTSW 11 67250792 missense probably benign 0.00
R6301:Myh4 UTSW 11 67255333 missense possibly damaging 0.95
R6318:Myh4 UTSW 11 67243442 missense probably benign 0.02
R6352:Myh4 UTSW 11 67252282 missense probably damaging 1.00
R6385:Myh4 UTSW 11 67255837 missense probably damaging 1.00
R6493:Myh4 UTSW 11 67258629 missense probably benign 0.16
R6666:Myh4 UTSW 11 67251812 missense probably damaging 1.00
R6826:Myh4 UTSW 11 67246531 missense probably damaging 1.00
R6852:Myh4 UTSW 11 67252968 splice site probably null
R6857:Myh4 UTSW 11 67249885 missense possibly damaging 0.74
R7029:Myh4 UTSW 11 67246425 missense probably benign 0.40
R7076:Myh4 UTSW 11 67253173 missense possibly damaging 0.85
R7145:Myh4 UTSW 11 67260228 missense possibly damaging 0.54
R7179:Myh4 UTSW 11 67244724 missense probably benign 0.32
R7365:Myh4 UTSW 11 67242848 missense probably damaging 1.00
R7514:Myh4 UTSW 11 67243322 critical splice donor site probably null
R7553:Myh4 UTSW 11 67256395 missense probably damaging 0.99
R7666:Myh4 UTSW 11 67256281 missense probably damaging 0.99
R7673:Myh4 UTSW 11 67245513 missense probably damaging 1.00
R7685:Myh4 UTSW 11 67240930 missense probably benign 0.13
X0027:Myh4 UTSW 11 67246480 missense probably damaging 1.00
Z1176:Myh4 UTSW 11 67248641 missense not run
Z1176:Myh4 UTSW 11 67253505 missense not run
Z1176:Myh4 UTSW 11 67256271 missense not run
Predicted Primers PCR Primer
(F):5'- GGGCAGGGACAGTGTAAGCATATTC -3'
(R):5'- TGCACGTAGTAGGCACTCAGCAAG -3'

Sequencing Primer
(F):5'- ACTTCTTTTAGCAGCAAAGGC -3'
(R):5'- GTGTTTAAGAAATAAATTGGCCCCC -3'
Posted On2013-05-09