Incidental Mutation 'R4592:Rbck1'
ID342882
Institutional Source Beutler Lab
Gene Symbol Rbck1
Ensembl Gene ENSMUSG00000027466
Gene NameRanBP-type and C3HC4-type zinc finger containing 1
SynonymsHOIL-1, HOIL-1L, Ubce7ip3
MMRRC Submission 041808-MU
Accession Numbers

Genbank: NM_001083921; MGI: 1344372

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4592 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location152316334-152332653 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 152318733 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 428 (Q428*)
Ref Sequence ENSEMBL: ENSMUSP00000105473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028963] [ENSMUST00000028964] [ENSMUST00000109847]
Predicted Effect probably benign
Transcript: ENSMUST00000028963
SMART Domains Protein: ENSMUSP00000028963
Gene: ENSMUSG00000027465

DomainStartEndE-ValueType
TBC 56 268 6.19e-5 SMART
low complexity region 304 323 N/A INTRINSIC
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000028964
AA Change: Q428*
SMART Domains Protein: ENSMUSP00000028964
Gene: ENSMUSG00000027466
AA Change: Q428*

DomainStartEndE-ValueType
PDB:4DBG|A 37 137 2e-60 PDB
Blast:UBQ 59 133 2e-15 BLAST
low complexity region 143 152 N/A INTRINSIC
ZnF_RBZ 193 217 5.25e-5 SMART
low complexity region 232 256 N/A INTRINSIC
RING 280 324 2.67e-5 SMART
Pfam:IBR 346 409 1.5e-9 PFAM
Pfam:IBR 422 483 2.5e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000109847
AA Change: Q428*
SMART Domains Protein: ENSMUSP00000105473
Gene: ENSMUSG00000027466
AA Change: Q428*

DomainStartEndE-ValueType
PDB:4DBG|A 37 137 2e-60 PDB
Blast:UBQ 59 133 2e-15 BLAST
low complexity region 143 152 N/A INTRINSIC
ZnF_RBZ 193 217 5.25e-5 SMART
low complexity region 232 256 N/A INTRINSIC
RING 280 324 2.67e-5 SMART
Blast:IBR 427 507 1e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130165
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140482
Predicted Effect probably benign
Transcript: ENSMUST00000144865
SMART Domains Protein: ENSMUSP00000118592
Gene: ENSMUSG00000027466

DomainStartEndE-ValueType
coiled coil region 13 41 N/A INTRINSIC
RING 63 107 2.67e-5 SMART
low complexity region 142 153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145889
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to mouse UIP28/UbcM4 interacting protein. Alternative splicing has been observed at this locus, resulting in distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased TNF-induced hepatocyte apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik A G 11: 97,771,615 S144P probably damaging Het
4933430I17Rik T A 4: 62,538,927 V161E possibly damaging Het
Arhgap40 T C 2: 158,546,709 V521A possibly damaging Het
Atrn T C 2: 130,999,130 probably benign Het
Casp12 T C 9: 5,352,923 probably benign Het
Ccdc189 C T 7: 127,585,491 R172H probably benign Het
Cenpf G A 1: 189,679,033 T318M probably damaging Het
Clcn2 T C 16: 20,709,142 K525E probably damaging Het
Cntln A G 4: 84,971,182 T301A probably benign Het
Crat T C 2: 30,415,366 probably benign Het
Cul5 A G 9: 53,633,727 probably benign Het
Cxcl14 A T 13: 56,295,895 I34N probably damaging Het
Cyp2b19 A G 7: 26,771,394 I487V probably benign Het
Cyp4a10 T A 4: 115,529,493 F446I probably damaging Het
D430041D05Rik T A 2: 104,233,479 M659L possibly damaging Het
Dclk3 T C 9: 111,467,895 F169S probably damaging Het
Ddx52 T C 11: 83,957,480 I532T probably damaging Het
Dnm1 T C 2: 32,336,011 D352G probably damaging Het
Eif4g2 T C 7: 111,078,302 E174G probably damaging Het
Enpp6 G T 8: 47,093,032 V386L probably damaging Het
Eps15l1 T C 8: 72,341,394 D904G probably damaging Het
Esrrb A G 12: 86,518,830 Y356C probably damaging Het
Flt3 A T 5: 147,354,699 S619T possibly damaging Het
Fndc7 A T 3: 108,858,902 C716S probably damaging Het
Gm10125 T C 18: 5,525,375 noncoding transcript Het
Gm26996 T A 6: 130,579,485 noncoding transcript Het
Grik2 A T 10: 49,422,615 F50I possibly damaging Het
Guf1 T C 5: 69,566,443 V367A possibly damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ifnar2 T C 16: 91,391,796 V55A probably benign Het
Impg1 T A 9: 80,440,854 I33F probably benign Het
Ltbp4 A C 7: 27,325,183 V674G probably damaging Het
Mroh2b T A 15: 4,918,290 L529H probably damaging Het
Negr1 T C 3: 157,208,386 probably benign Het
Neurog3 A G 10: 62,133,820 T25A probably damaging Het
Olfr1241 T A 2: 89,482,756 K126N probably damaging Het
Olfr1420 T C 19: 11,896,762 V247A probably benign Het
Olfr181 T C 16: 58,926,092 T160A probably benign Het
Olfr555 A C 7: 102,659,478 Y219S probably damaging Het
Pax8 T A 2: 24,443,189 probably benign Het
Pcsk6 A C 7: 65,931,732 I254L possibly damaging Het
Pde3a A G 6: 141,459,216 K389R probably benign Het
Rab3gap1 C A 1: 127,925,259 probably benign Het
Rptor A G 11: 119,798,840 D321G probably null Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Sdccag3 C A 2: 26,388,897 probably benign Het
Skp1a T C 11: 52,243,619 I59T possibly damaging Het
Slc23a3 T G 1: 75,128,556 N456T probably damaging Het
Slc4a7 G A 14: 14,778,850 G920S probably damaging Het
Smarcd3 T C 5: 24,592,804 I467V probably benign Het
Spata31d1c C T 13: 65,036,060 A472V probably damaging Het
Srsf6 T C 2: 162,931,723 I18T probably damaging Het
Stom C T 2: 35,323,746 G80D probably damaging Het
Svep1 A T 4: 58,084,028 Y1915N possibly damaging Het
Tmf1 C T 6: 97,173,400 V449I probably benign Het
Triobp C T 15: 78,967,095 A483V probably benign Het
Vdac1 G A 11: 52,374,972 probably null Het
Vmn2r75 T G 7: 86,166,286 E123D probably benign Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Zdbf2 T G 1: 63,306,591 N1376K possibly damaging Het
Other mutations in Rbck1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Rbck1 APN 2 152318395 missense probably damaging 0.98
IGL00765:Rbck1 APN 2 152330954 splice site probably benign
IGL01647:Rbck1 APN 2 152323232 missense probably damaging 1.00
IGL01945:Rbck1 APN 2 152318316 missense probably damaging 1.00
IGL02141:Rbck1 APN 2 152318374 missense possibly damaging 0.56
IGL02573:Rbck1 APN 2 152322167 missense possibly damaging 0.90
IGL02950:Rbck1 APN 2 152331077 missense possibly damaging 0.95
green_fire UTSW 2 152323174 nonsense probably null
iron_throne UTSW 2 152318451 missense probably benign 0.45
Viserion UTSW 2 152330966 missense possibly damaging 0.87
westeros UTSW 2 152318733 nonsense probably null
A4554:Rbck1 UTSW 2 152319172 missense probably damaging 1.00
R0532:Rbck1 UTSW 2 152324330 missense probably damaging 0.99
R1426:Rbck1 UTSW 2 152327241 unclassified probably benign
R1598:Rbck1 UTSW 2 152323170 critical splice donor site probably null
R1666:Rbck1 UTSW 2 152316899 missense probably damaging 0.99
R1668:Rbck1 UTSW 2 152316899 missense probably damaging 0.99
R1889:Rbck1 UTSW 2 152318356 missense probably damaging 0.99
R4572:Rbck1 UTSW 2 152318733 nonsense probably null
R5077:Rbck1 UTSW 2 152318451 missense probably benign 0.45
R6049:Rbck1 UTSW 2 152323174 nonsense probably null
R6494:Rbck1 UTSW 2 152330966 missense possibly damaging 0.87
R7530:Rbck1 UTSW 2 152324292 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- TAGCCACCACTTCGTTACAG -3'
(R):5'- GCTTTCTAAGTGAGGGCTTTCAC -3'

Sequencing Primer
(F):5'- ACCACTTCGTTACAGAGGGCTC -3'
(R):5'- AGGGCTTTCACTGATGGCAC -3'
Posted On2015-09-24