Incidental Mutation 'R4592:Srsf6'
ID342883
Institutional Source Beutler Lab
Gene Symbol Srsf6
Ensembl Gene ENSMUSG00000016921
Gene Nameserine/arginine-rich splicing factor 6
SynonymsSfrs6, 1210001E11Rik
MMRRC Submission 041808-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.779) question?
Stock #R4592 (G1)
Quality Score140
Status Validated
Chromosome2
Chromosomal Location162931528-162937121 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 162931723 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 18 (I18T)
Ref Sequence ENSEMBL: ENSMUSP00000141349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017065] [ENSMUST00000126163] [ENSMUST00000130411]
Predicted Effect probably damaging
Transcript: ENSMUST00000017065
AA Change: I18T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142183
Gene: ENSMUSG00000016921
AA Change: I18T

DomainStartEndE-ValueType
RRM 3 68 2.62e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000126163
AA Change: I18T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141349
Gene: ENSMUSG00000016921
AA Change: I18T

DomainStartEndE-ValueType
RRM 3 68 2.62e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130411
AA Change: I18T

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000119065
Gene: ENSMUSG00000016921
AA Change: I18T

DomainStartEndE-ValueType
RRM 3 68 2.62e-18 SMART
low complexity region 74 100 N/A INTRINSIC
RRM 111 179 6.97e-14 SMART
low complexity region 184 280 N/A INTRINSIC
low complexity region 291 303 N/A INTRINSIC
low complexity region 313 338 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193611
Meta Mutation Damage Score 0.8156 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik A G 11: 97,771,615 S144P probably damaging Het
4933430I17Rik T A 4: 62,538,927 V161E possibly damaging Het
Arhgap40 T C 2: 158,546,709 V521A possibly damaging Het
Atrn T C 2: 130,999,130 probably benign Het
Casp12 T C 9: 5,352,923 probably benign Het
Ccdc189 C T 7: 127,585,491 R172H probably benign Het
Cenpf G A 1: 189,679,033 T318M probably damaging Het
Clcn2 T C 16: 20,709,142 K525E probably damaging Het
Cntln A G 4: 84,971,182 T301A probably benign Het
Crat T C 2: 30,415,366 probably benign Het
Cul5 A G 9: 53,633,727 probably benign Het
Cxcl14 A T 13: 56,295,895 I34N probably damaging Het
Cyp2b19 A G 7: 26,771,394 I487V probably benign Het
Cyp4a10 T A 4: 115,529,493 F446I probably damaging Het
D430041D05Rik T A 2: 104,233,479 M659L possibly damaging Het
Dclk3 T C 9: 111,467,895 F169S probably damaging Het
Ddx52 T C 11: 83,957,480 I532T probably damaging Het
Dnm1 T C 2: 32,336,011 D352G probably damaging Het
Eif4g2 T C 7: 111,078,302 E174G probably damaging Het
Enpp6 G T 8: 47,093,032 V386L probably damaging Het
Eps15l1 T C 8: 72,341,394 D904G probably damaging Het
Esrrb A G 12: 86,518,830 Y356C probably damaging Het
Flt3 A T 5: 147,354,699 S619T possibly damaging Het
Fndc7 A T 3: 108,858,902 C716S probably damaging Het
Gm10125 T C 18: 5,525,375 noncoding transcript Het
Gm26996 T A 6: 130,579,485 noncoding transcript Het
Grik2 A T 10: 49,422,615 F50I possibly damaging Het
Guf1 T C 5: 69,566,443 V367A possibly damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ifnar2 T C 16: 91,391,796 V55A probably benign Het
Impg1 T A 9: 80,440,854 I33F probably benign Het
Ltbp4 A C 7: 27,325,183 V674G probably damaging Het
Mroh2b T A 15: 4,918,290 L529H probably damaging Het
Negr1 T C 3: 157,208,386 probably benign Het
Neurog3 A G 10: 62,133,820 T25A probably damaging Het
Olfr1241 T A 2: 89,482,756 K126N probably damaging Het
Olfr1420 T C 19: 11,896,762 V247A probably benign Het
Olfr181 T C 16: 58,926,092 T160A probably benign Het
Olfr555 A C 7: 102,659,478 Y219S probably damaging Het
Pax8 T A 2: 24,443,189 probably benign Het
Pcsk6 A C 7: 65,931,732 I254L possibly damaging Het
Pde3a A G 6: 141,459,216 K389R probably benign Het
Rab3gap1 C A 1: 127,925,259 probably benign Het
Rbck1 G A 2: 152,318,733 Q428* probably null Het
Rptor A G 11: 119,798,840 D321G probably null Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Sdccag3 C A 2: 26,388,897 probably benign Het
Skp1a T C 11: 52,243,619 I59T possibly damaging Het
Slc23a3 T G 1: 75,128,556 N456T probably damaging Het
Slc4a7 G A 14: 14,778,850 G920S probably damaging Het
Smarcd3 T C 5: 24,592,804 I467V probably benign Het
Spata31d1c C T 13: 65,036,060 A472V probably damaging Het
Stom C T 2: 35,323,746 G80D probably damaging Het
Svep1 A T 4: 58,084,028 Y1915N possibly damaging Het
Tmf1 C T 6: 97,173,400 V449I probably benign Het
Triobp C T 15: 78,967,095 A483V probably benign Het
Vdac1 G A 11: 52,374,972 probably null Het
Vmn2r75 T G 7: 86,166,286 E123D probably benign Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Zdbf2 T G 1: 63,306,591 N1376K possibly damaging Het
Other mutations in Srsf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Srsf6 APN 2 162931707 missense probably damaging 1.00
IGL01960:Srsf6 APN 2 162933754 missense probably damaging 1.00
R1292:Srsf6 UTSW 2 162934483 unclassified probably benign
R1789:Srsf6 UTSW 2 162934488 unclassified probably benign
R1936:Srsf6 UTSW 2 162934483 unclassified probably benign
R1937:Srsf6 UTSW 2 162934483 unclassified probably benign
R1939:Srsf6 UTSW 2 162934483 unclassified probably benign
R1940:Srsf6 UTSW 2 162934483 unclassified probably benign
R2225:Srsf6 UTSW 2 162931699 missense probably damaging 1.00
R2226:Srsf6 UTSW 2 162931699 missense probably damaging 1.00
R2227:Srsf6 UTSW 2 162931699 missense probably damaging 1.00
R4026:Srsf6 UTSW 2 162934291 unclassified probably benign
R4290:Srsf6 UTSW 2 162934716 unclassified probably benign
R4292:Srsf6 UTSW 2 162934716 unclassified probably benign
R4293:Srsf6 UTSW 2 162934716 unclassified probably benign
R4294:Srsf6 UTSW 2 162934716 unclassified probably benign
R4295:Srsf6 UTSW 2 162934716 unclassified probably benign
R4613:Srsf6 UTSW 2 162933709 missense probably benign 0.45
R4657:Srsf6 UTSW 2 162933427 missense probably benign 0.01
R7378:Srsf6 UTSW 2 162934569 missense unknown
R7446:Srsf6 UTSW 2 162934716 missense unknown
R7578:Srsf6 UTSW 2 162932862 missense probably benign 0.00
R7730:Srsf6 UTSW 2 162931723 missense probably damaging 0.99
R7908:Srsf6 UTSW 2 162933840 missense unknown
X0020:Srsf6 UTSW 2 162933498 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTTTACGCTGATGGCTGC -3'
(R):5'- TTGAGCTCGTACACGGCATC -3'

Sequencing Primer
(F):5'- ACTTATAGCGTAGGCCGGC -3'
(R):5'- GGAGTCCTCGAACTCCACG -3'
Posted On2015-09-24