Incidental Mutation 'R4592:Cntln'
ID 342888
Institutional Source Beutler Lab
Gene Symbol Cntln
Ensembl Gene ENSMUSG00000038070
Gene Name centlein, centrosomal protein
Synonyms D530005L17Rik, B430108F07Rik
MMRRC Submission 041808-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.317) question?
Stock # R4592 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 84802546-85050158 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84889419 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 301 (T301A)
Ref Sequence ENSEMBL: ENSMUSP00000130491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000169371]
AlphaFold A2AM05
Predicted Effect probably benign
Transcript: ENSMUST00000047023
AA Change: T301A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: T301A

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.25e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.25e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 973 1114 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Blast:HisKA 1270 1326 1e-24 BLAST
low complexity region 1327 1348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169371
AA Change: T301A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: T301A

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.24e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.24e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 972 1113 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Blast:HisKA 1269 1325 1e-24 BLAST
low complexity region 1326 1347 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,457,164 (GRCm39) V161E possibly damaging Het
Arhgap40 T C 2: 158,388,629 (GRCm39) V521A possibly damaging Het
Atrn T C 2: 130,841,050 (GRCm39) probably benign Het
Casp12 T C 9: 5,352,923 (GRCm39) probably benign Het
Cenpf G A 1: 189,411,230 (GRCm39) T318M probably damaging Het
Cfap119 C T 7: 127,184,663 (GRCm39) R172H probably benign Het
Clcn2 T C 16: 20,527,892 (GRCm39) K525E probably damaging Het
Crat T C 2: 30,305,378 (GRCm39) probably benign Het
Cul5 A G 9: 53,545,027 (GRCm39) probably benign Het
Cxcl14 A T 13: 56,443,708 (GRCm39) I34N probably damaging Het
Cyp2b19 A G 7: 26,470,819 (GRCm39) I487V probably benign Het
Cyp4a10 T A 4: 115,386,690 (GRCm39) F446I probably damaging Het
D430041D05Rik T A 2: 104,063,824 (GRCm39) M659L possibly damaging Het
Dclk3 T C 9: 111,296,963 (GRCm39) F169S probably damaging Het
Ddx52 T C 11: 83,848,306 (GRCm39) I532T probably damaging Het
Dnm1 T C 2: 32,226,023 (GRCm39) D352G probably damaging Het
Eif4g2 T C 7: 110,677,509 (GRCm39) E174G probably damaging Het
Enpp6 G T 8: 47,546,067 (GRCm39) V386L probably damaging Het
Entr1 C A 2: 26,278,909 (GRCm39) probably benign Het
Eps15l1 T C 8: 73,095,238 (GRCm39) D904G probably damaging Het
Esrrb A G 12: 86,565,604 (GRCm39) Y356C probably damaging Het
Flt3 A T 5: 147,291,509 (GRCm39) S619T possibly damaging Het
Fndc7 A T 3: 108,766,218 (GRCm39) C716S probably damaging Het
Gm26996 T A 6: 130,556,448 (GRCm39) noncoding transcript Het
Grik2 A T 10: 49,298,711 (GRCm39) F50I possibly damaging Het
Guf1 T C 5: 69,723,786 (GRCm39) V367A possibly damaging Het
Hspg2 C T 4: 137,246,251 (GRCm39) R1010C probably damaging Het
Ifnar2 T C 16: 91,188,684 (GRCm39) V55A probably benign Het
Impg1 T A 9: 80,322,907 (GRCm39) I33F probably benign Het
Ltbp4 A C 7: 27,024,608 (GRCm39) V674G probably damaging Het
Mroh2b T A 15: 4,947,772 (GRCm39) L529H probably damaging Het
Negr1 T C 3: 156,914,023 (GRCm39) probably benign Het
Neurog3 A G 10: 61,969,599 (GRCm39) T25A probably damaging Het
Or10v1 T C 19: 11,874,126 (GRCm39) V247A probably benign Het
Or4a69 T A 2: 89,313,100 (GRCm39) K126N probably damaging Het
Or51h1 A C 7: 102,308,685 (GRCm39) Y219S probably damaging Het
Or5k17 T C 16: 58,746,455 (GRCm39) T160A probably benign Het
Pax8 T A 2: 24,333,201 (GRCm39) probably benign Het
Pcsk6 A C 7: 65,581,480 (GRCm39) I254L possibly damaging Het
Pde3a A G 6: 141,404,942 (GRCm39) K389R probably benign Het
Rab3gap1 C A 1: 127,852,996 (GRCm39) probably benign Het
Rbck1 G A 2: 152,160,653 (GRCm39) Q428* probably null Het
Rptor A G 11: 119,689,666 (GRCm39) D321G probably null Het
Sall2 C A 14: 52,551,260 (GRCm39) R643L probably damaging Het
Skp1 T C 11: 52,134,446 (GRCm39) I59T possibly damaging Het
Slc23a3 T G 1: 75,105,200 (GRCm39) N456T probably damaging Het
Slc4a7 G A 14: 14,778,850 (GRCm38) G920S probably damaging Het
Smarcd3 T C 5: 24,797,802 (GRCm39) I467V probably benign Het
Spata31d1c C T 13: 65,183,874 (GRCm39) A472V probably damaging Het
Spmap1 A G 11: 97,662,441 (GRCm39) S144P probably damaging Het
Srsf6 T C 2: 162,773,643 (GRCm39) I18T probably damaging Het
Stom C T 2: 35,213,758 (GRCm39) G80D probably damaging Het
Svep1 A T 4: 58,084,028 (GRCm39) Y1915N possibly damaging Het
Tmf1 C T 6: 97,150,361 (GRCm39) V449I probably benign Het
Triobp C T 15: 78,851,295 (GRCm39) A483V probably benign Het
Vdac1 G A 11: 52,265,799 (GRCm39) probably null Het
Vmn2r75 T G 7: 85,815,494 (GRCm39) E123D probably benign Het
Vmn2r79 T A 7: 86,653,319 (GRCm39) V528D possibly damaging Het
Zdbf2 T G 1: 63,345,750 (GRCm39) N1376K possibly damaging Het
Zeb1os1 T C 18: 5,525,375 (GRCm39) noncoding transcript Het
Other mutations in Cntln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Cntln APN 4 84,924,671 (GRCm39) missense probably benign 0.25
IGL00743:Cntln APN 4 84,897,652 (GRCm39) missense probably benign 0.06
IGL01014:Cntln APN 4 84,968,145 (GRCm39) missense probably benign 0.25
IGL02217:Cntln APN 4 85,018,495 (GRCm39) missense probably damaging 1.00
IGL02323:Cntln APN 4 84,968,026 (GRCm39) missense probably benign 0.00
IGL02353:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02360:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02616:Cntln APN 4 85,033,689 (GRCm39) critical splice donor site probably null
PIT4696001:Cntln UTSW 4 84,892,237 (GRCm39) missense probably damaging 0.99
R0110:Cntln UTSW 4 85,014,994 (GRCm39) missense probably damaging 1.00
R0324:Cntln UTSW 4 85,010,932 (GRCm39) missense probably damaging 0.98
R0349:Cntln UTSW 4 84,914,722 (GRCm39) missense probably damaging 1.00
R0519:Cntln UTSW 4 84,923,290 (GRCm39) splice site probably benign
R0529:Cntln UTSW 4 84,986,062 (GRCm39) missense probably damaging 1.00
R0582:Cntln UTSW 4 84,802,978 (GRCm39) missense probably damaging 1.00
R1077:Cntln UTSW 4 84,914,716 (GRCm39) missense probably damaging 1.00
R1345:Cntln UTSW 4 84,892,228 (GRCm39) missense probably damaging 1.00
R1457:Cntln UTSW 4 85,015,076 (GRCm39) missense probably benign 0.33
R1571:Cntln UTSW 4 84,865,823 (GRCm39) nonsense probably null
R1622:Cntln UTSW 4 84,981,418 (GRCm39) missense probably damaging 1.00
R1681:Cntln UTSW 4 84,865,872 (GRCm39) missense probably damaging 1.00
R1777:Cntln UTSW 4 85,048,916 (GRCm39) missense probably benign 0.23
R1808:Cntln UTSW 4 85,015,000 (GRCm39) missense probably damaging 1.00
R1882:Cntln UTSW 4 85,019,072 (GRCm39) missense probably damaging 1.00
R2056:Cntln UTSW 4 84,967,911 (GRCm39) missense probably benign
R2965:Cntln UTSW 4 84,892,264 (GRCm39) critical splice donor site probably null
R2968:Cntln UTSW 4 84,875,504 (GRCm39) missense probably benign 0.27
R3104:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3106:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3121:Cntln UTSW 4 84,923,289 (GRCm39) splice site probably benign
R3617:Cntln UTSW 4 84,923,214 (GRCm39) nonsense probably null
R4009:Cntln UTSW 4 84,981,452 (GRCm39) missense probably benign 0.45
R4036:Cntln UTSW 4 84,924,725 (GRCm39) missense probably damaging 1.00
R4548:Cntln UTSW 4 85,015,079 (GRCm39) missense probably benign 0.27
R4666:Cntln UTSW 4 84,889,453 (GRCm39) missense probably benign 0.13
R4826:Cntln UTSW 4 84,923,281 (GRCm39) missense probably benign 0.03
R4836:Cntln UTSW 4 84,967,957 (GRCm39) nonsense probably null
R4856:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R4886:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R4995:Cntln UTSW 4 84,968,120 (GRCm39) missense probably benign 0.00
R5090:Cntln UTSW 4 84,865,830 (GRCm39) missense probably damaging 0.98
R5202:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R5905:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R5953:Cntln UTSW 4 84,968,156 (GRCm39) missense possibly damaging 0.92
R6028:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R6298:Cntln UTSW 4 85,014,998 (GRCm39) missense probably damaging 1.00
R6351:Cntln UTSW 4 85,033,591 (GRCm39) missense probably damaging 0.99
R6371:Cntln UTSW 4 84,802,816 (GRCm39) missense probably damaging 0.98
R6481:Cntln UTSW 4 84,985,747 (GRCm39) missense probably benign 0.00
R6864:Cntln UTSW 4 85,015,029 (GRCm39) missense probably damaging 0.99
R6874:Cntln UTSW 4 84,985,996 (GRCm39) missense probably damaging 1.00
R6919:Cntln UTSW 4 85,033,605 (GRCm39) missense probably benign 0.04
R7071:Cntln UTSW 4 85,018,622 (GRCm39) missense probably damaging 1.00
R7113:Cntln UTSW 4 84,968,064 (GRCm39) missense probably damaging 0.98
R7152:Cntln UTSW 4 84,802,937 (GRCm39) missense possibly damaging 0.87
R7253:Cntln UTSW 4 85,036,710 (GRCm39) missense probably damaging 1.00
R7289:Cntln UTSW 4 84,964,540 (GRCm39) missense possibly damaging 0.80
R7440:Cntln UTSW 4 84,981,453 (GRCm39) missense possibly damaging 0.95
R7670:Cntln UTSW 4 84,897,577 (GRCm39) missense possibly damaging 0.66
R7707:Cntln UTSW 4 84,802,853 (GRCm39) missense probably damaging 1.00
R7895:Cntln UTSW 4 84,981,561 (GRCm39) missense possibly damaging 0.91
R8176:Cntln UTSW 4 84,806,926 (GRCm39) missense probably damaging 0.99
R8247:Cntln UTSW 4 85,019,017 (GRCm39) missense probably benign 0.39
R8264:Cntln UTSW 4 85,016,648 (GRCm39) missense probably damaging 1.00
R8293:Cntln UTSW 4 84,952,075 (GRCm39) missense probably damaging 1.00
R8536:Cntln UTSW 4 84,875,286 (GRCm39) missense probably damaging 1.00
R8844:Cntln UTSW 4 84,892,234 (GRCm39) missense probably damaging 1.00
R8924:Cntln UTSW 4 84,806,936 (GRCm39) missense probably damaging 1.00
R8955:Cntln UTSW 4 84,986,110 (GRCm39) missense possibly damaging 0.85
R8960:Cntln UTSW 4 85,018,961 (GRCm39) missense possibly damaging 0.59
R8979:Cntln UTSW 4 85,048,910 (GRCm39) missense probably damaging 1.00
R9255:Cntln UTSW 4 85,019,103 (GRCm39) missense possibly damaging 0.93
R9314:Cntln UTSW 4 84,924,719 (GRCm39) missense probably damaging 1.00
R9353:Cntln UTSW 4 84,802,597 (GRCm39) unclassified probably benign
R9361:Cntln UTSW 4 84,968,151 (GRCm39) missense probably benign 0.23
R9376:Cntln UTSW 4 84,875,258 (GRCm39) missense probably benign 0.24
R9382:Cntln UTSW 4 84,968,318 (GRCm39) missense probably benign 0.13
R9471:Cntln UTSW 4 84,968,019 (GRCm39) missense possibly damaging 0.62
R9478:Cntln UTSW 4 84,897,630 (GRCm39) missense probably benign 0.00
R9527:Cntln UTSW 4 84,892,120 (GRCm39) missense probably damaging 1.00
R9788:Cntln UTSW 4 84,968,093 (GRCm39) missense probably damaging 1.00
R9793:Cntln UTSW 4 84,985,798 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTAAGTGTCTAGCAGGATACAGAGATG -3'
(R):5'- CGCTTTAGTCACACTATTCCGG -3'

Sequencing Primer
(F):5'- GAGATGAATCCTGTACATTCCCC -3'
(R):5'- GCCTATGGGAGACATACTGTTATC -3'
Posted On 2015-09-24