Incidental Mutation 'R4592:Guf1'
ID342891
Institutional Source Beutler Lab
Gene Symbol Guf1
Ensembl Gene ENSMUSG00000029208
Gene NameGUF1 homolog, GTPase
Synonyms
MMRRC Submission 041808-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.642) question?
Stock #R4592 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location69556923-69575973 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69566443 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 367 (V367A)
Ref Sequence ENSEMBL: ENSMUSP00000031113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031113] [ENSMUST00000087228] [ENSMUST00000132169] [ENSMUST00000144363] [ENSMUST00000154728] [ENSMUST00000173205]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031113
AA Change: V367A

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000031113
Gene: ENSMUSG00000029208
AA Change: V367A

DomainStartEndE-ValueType
low complexity region 7 29 N/A INTRINSIC
Pfam:GTP_EFTU 48 227 2.9e-53 PFAM
Pfam:MMR_HSR1 52 177 1.1e-7 PFAM
Pfam:Ras 83 227 2.4e-7 PFAM
low complexity region 336 349 N/A INTRINSIC
EFG_C 364 450 9.13e-1 SMART
Pfam:LepA_C 452 559 3.1e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000087228
AA Change: V455A

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000084480
Gene: ENSMUSG00000029208
AA Change: V455A

DomainStartEndE-ValueType
low complexity region 7 29 N/A INTRINSIC
Pfam:GTP_EFTU 48 227 3.1e-54 PFAM
Pfam:MMR_HSR1 52 177 4.1e-6 PFAM
Pfam:Ras 83 226 2.9e-7 PFAM
Pfam:GTP_EFTU_D2 250 320 7e-10 PFAM
low complexity region 424 437 N/A INTRINSIC
EFG_C 452 538 9.13e-1 SMART
Pfam:LepA_C 540 646 1.3e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125660
Predicted Effect probably benign
Transcript: ENSMUST00000132169
SMART Domains Protein: ENSMUSP00000144290
Gene: ENSMUSG00000029208

DomainStartEndE-ValueType
low complexity region 7 29 N/A INTRINSIC
Pfam:GTP_EFTU 48 227 6.2e-54 PFAM
Pfam:MMR_HSR1 52 177 6.2e-6 PFAM
Pfam:Ras 83 226 1.2e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144363
SMART Domains Protein: ENSMUSP00000114707
Gene: ENSMUSG00000029208

DomainStartEndE-ValueType
low complexity region 1 23 N/A INTRINSIC
Pfam:GTP_EFTU 42 221 5.8e-54 PFAM
Pfam:MMR_HSR1 46 171 5.9e-6 PFAM
Pfam:Ras 77 220 1.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154728
SMART Domains Protein: ENSMUSP00000144246
Gene: ENSMUSG00000029208

DomainStartEndE-ValueType
low complexity region 7 29 N/A INTRINSIC
Pfam:GTP_EFTU 48 227 6.2e-54 PFAM
Pfam:MMR_HSR1 52 177 6.2e-6 PFAM
Pfam:Ras 83 226 1.2e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173205
SMART Domains Protein: ENSMUSP00000133467
Gene: ENSMUSG00000029208

DomainStartEndE-ValueType
Pfam:GTP_EFTU 11 190 1.1e-53 PFAM
Pfam:MMR_HSR1 15 140 2.6e-8 PFAM
Pfam:Ras 46 190 1.6e-7 PFAM
Pfam:GTP_EFTU_D2 213 283 3.1e-9 PFAM
Pfam:EFG_C 369 454 1e-16 PFAM
Pfam:LepA_C 455 562 4.5e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202180
Meta Mutation Damage Score 0.0876 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a GTPase that triggers back-translocation of the elongating ribosome during mitochondrial protein synthesis. The protein contains a highly conserved C-terminal domain not found in other GTPases that facilitates tRNA binding. The encoded protein is thought to prevent misincorporation of amino acids in stressful, suboptimal conditions. An allelic variant in this gene has been associated with early infantile epileptic encephalopathy-40. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik A G 11: 97,771,615 S144P probably damaging Het
4933430I17Rik T A 4: 62,538,927 V161E possibly damaging Het
Arhgap40 T C 2: 158,546,709 V521A possibly damaging Het
Atrn T C 2: 130,999,130 probably benign Het
Casp12 T C 9: 5,352,923 probably benign Het
Ccdc189 C T 7: 127,585,491 R172H probably benign Het
Cenpf G A 1: 189,679,033 T318M probably damaging Het
Clcn2 T C 16: 20,709,142 K525E probably damaging Het
Cntln A G 4: 84,971,182 T301A probably benign Het
Crat T C 2: 30,415,366 probably benign Het
Cul5 A G 9: 53,633,727 probably benign Het
Cxcl14 A T 13: 56,295,895 I34N probably damaging Het
Cyp2b19 A G 7: 26,771,394 I487V probably benign Het
Cyp4a10 T A 4: 115,529,493 F446I probably damaging Het
D430041D05Rik T A 2: 104,233,479 M659L possibly damaging Het
Dclk3 T C 9: 111,467,895 F169S probably damaging Het
Ddx52 T C 11: 83,957,480 I532T probably damaging Het
Dnm1 T C 2: 32,336,011 D352G probably damaging Het
Eif4g2 T C 7: 111,078,302 E174G probably damaging Het
Enpp6 G T 8: 47,093,032 V386L probably damaging Het
Eps15l1 T C 8: 72,341,394 D904G probably damaging Het
Esrrb A G 12: 86,518,830 Y356C probably damaging Het
Flt3 A T 5: 147,354,699 S619T possibly damaging Het
Fndc7 A T 3: 108,858,902 C716S probably damaging Het
Gm10125 T C 18: 5,525,375 noncoding transcript Het
Gm26996 T A 6: 130,579,485 noncoding transcript Het
Grik2 A T 10: 49,422,615 F50I possibly damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ifnar2 T C 16: 91,391,796 V55A probably benign Het
Impg1 T A 9: 80,440,854 I33F probably benign Het
Ltbp4 A C 7: 27,325,183 V674G probably damaging Het
Mroh2b T A 15: 4,918,290 L529H probably damaging Het
Negr1 T C 3: 157,208,386 probably benign Het
Neurog3 A G 10: 62,133,820 T25A probably damaging Het
Olfr1241 T A 2: 89,482,756 K126N probably damaging Het
Olfr1420 T C 19: 11,896,762 V247A probably benign Het
Olfr181 T C 16: 58,926,092 T160A probably benign Het
Olfr555 A C 7: 102,659,478 Y219S probably damaging Het
Pax8 T A 2: 24,443,189 probably benign Het
Pcsk6 A C 7: 65,931,732 I254L possibly damaging Het
Pde3a A G 6: 141,459,216 K389R probably benign Het
Rab3gap1 C A 1: 127,925,259 probably benign Het
Rbck1 G A 2: 152,318,733 Q428* probably null Het
Rptor A G 11: 119,798,840 D321G probably null Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Sdccag3 C A 2: 26,388,897 probably benign Het
Skp1a T C 11: 52,243,619 I59T possibly damaging Het
Slc23a3 T G 1: 75,128,556 N456T probably damaging Het
Slc4a7 G A 14: 14,778,850 G920S probably damaging Het
Smarcd3 T C 5: 24,592,804 I467V probably benign Het
Spata31d1c C T 13: 65,036,060 A472V probably damaging Het
Srsf6 T C 2: 162,931,723 I18T probably damaging Het
Stom C T 2: 35,323,746 G80D probably damaging Het
Svep1 A T 4: 58,084,028 Y1915N possibly damaging Het
Tmf1 C T 6: 97,173,400 V449I probably benign Het
Triobp C T 15: 78,967,095 A483V probably benign Het
Vdac1 G A 11: 52,374,972 probably null Het
Vmn2r75 T G 7: 86,166,286 E123D probably benign Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Zdbf2 T G 1: 63,306,591 N1376K possibly damaging Het
Other mutations in Guf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01580:Guf1 APN 5 69565421 splice site probably benign
IGL01739:Guf1 APN 5 69561158 missense probably damaging 1.00
IGL03110:Guf1 APN 5 69558477 missense probably damaging 1.00
R0054:Guf1 UTSW 5 69559561 synonymous silent
R0219:Guf1 UTSW 5 69559586 missense probably damaging 1.00
R0269:Guf1 UTSW 5 69559599 missense probably damaging 0.99
R0624:Guf1 UTSW 5 69558580 missense probably damaging 1.00
R0690:Guf1 UTSW 5 69566352 intron probably null
R0906:Guf1 UTSW 5 69566386 missense probably damaging 0.99
R1082:Guf1 UTSW 5 69567212 missense possibly damaging 0.95
R1386:Guf1 UTSW 5 69563162 missense probably benign
R1506:Guf1 UTSW 5 69567166 missense possibly damaging 0.85
R1859:Guf1 UTSW 5 69568460 nonsense probably null
R1982:Guf1 UTSW 5 69567226 nonsense probably null
R3782:Guf1 UTSW 5 69567152 missense probably benign 0.01
R3847:Guf1 UTSW 5 69561157 missense probably damaging 0.99
R4172:Guf1 UTSW 5 69558229 missense possibly damaging 0.88
R4513:Guf1 UTSW 5 69561662 missense probably benign 0.00
R4811:Guf1 UTSW 5 69564509 splice site probably null
R5435:Guf1 UTSW 5 69563169 missense probably benign 0.01
R5792:Guf1 UTSW 5 69560486 missense probably damaging 1.00
R6181:Guf1 UTSW 5 69561716 missense probably damaging 1.00
R6246:Guf1 UTSW 5 69558555 missense probably damaging 1.00
R6411:Guf1 UTSW 5 69560511 missense possibly damaging 0.87
R6701:Guf1 UTSW 5 69558253 missense probably damaging 1.00
R6724:Guf1 UTSW 5 69566393 missense probably damaging 0.99
R7634:Guf1 UTSW 5 69564544 missense probably damaging 0.97
X0018:Guf1 UTSW 5 69566366 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGTGAATGCAGTCTGTTCTAAATG -3'
(R):5'- TCTATAAGCAAGAGTTTTGGGGAAG -3'

Sequencing Primer
(F):5'- GTACTATCTGTGAAAAGCAAGCCTG -3'
(R):5'- GAGACAAGGTTTCTCTGTATAGCCC -3'
Posted On2015-09-24