Incidental Mutation 'R4592:Cyp2b19'
ID342897
Institutional Source Beutler Lab
Gene Symbol Cyp2b19
Ensembl Gene ENSMUSG00000066704
Gene Namecytochrome P450, family 2, subfamily b, polypeptide 19
Synonyms
MMRRC Submission 041808-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R4592 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location26757142-26772630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26771394 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 487 (I487V)
Ref Sequence ENSEMBL: ENSMUSP00000077021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077855]
Predicted Effect probably benign
Transcript: ENSMUST00000077855
AA Change: I487V

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000077021
Gene: ENSMUSG00000066704
AA Change: I487V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:p450 32 489 8.7e-151 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138018
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik A G 11: 97,771,615 S144P probably damaging Het
4933430I17Rik T A 4: 62,538,927 V161E possibly damaging Het
Arhgap40 T C 2: 158,546,709 V521A possibly damaging Het
Atrn T C 2: 130,999,130 probably benign Het
Casp12 T C 9: 5,352,923 probably benign Het
Ccdc189 C T 7: 127,585,491 R172H probably benign Het
Cenpf G A 1: 189,679,033 T318M probably damaging Het
Clcn2 T C 16: 20,709,142 K525E probably damaging Het
Cntln A G 4: 84,971,182 T301A probably benign Het
Crat T C 2: 30,415,366 probably benign Het
Cul5 A G 9: 53,633,727 probably benign Het
Cxcl14 A T 13: 56,295,895 I34N probably damaging Het
Cyp4a10 T A 4: 115,529,493 F446I probably damaging Het
D430041D05Rik T A 2: 104,233,479 M659L possibly damaging Het
Dclk3 T C 9: 111,467,895 F169S probably damaging Het
Ddx52 T C 11: 83,957,480 I532T probably damaging Het
Dnm1 T C 2: 32,336,011 D352G probably damaging Het
Eif4g2 T C 7: 111,078,302 E174G probably damaging Het
Enpp6 G T 8: 47,093,032 V386L probably damaging Het
Eps15l1 T C 8: 72,341,394 D904G probably damaging Het
Esrrb A G 12: 86,518,830 Y356C probably damaging Het
Flt3 A T 5: 147,354,699 S619T possibly damaging Het
Fndc7 A T 3: 108,858,902 C716S probably damaging Het
Gm10125 T C 18: 5,525,375 noncoding transcript Het
Gm26996 T A 6: 130,579,485 noncoding transcript Het
Grik2 A T 10: 49,422,615 F50I possibly damaging Het
Guf1 T C 5: 69,566,443 V367A possibly damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ifnar2 T C 16: 91,391,796 V55A probably benign Het
Impg1 T A 9: 80,440,854 I33F probably benign Het
Ltbp4 A C 7: 27,325,183 V674G probably damaging Het
Mroh2b T A 15: 4,918,290 L529H probably damaging Het
Negr1 T C 3: 157,208,386 probably benign Het
Neurog3 A G 10: 62,133,820 T25A probably damaging Het
Olfr1241 T A 2: 89,482,756 K126N probably damaging Het
Olfr1420 T C 19: 11,896,762 V247A probably benign Het
Olfr181 T C 16: 58,926,092 T160A probably benign Het
Olfr555 A C 7: 102,659,478 Y219S probably damaging Het
Pax8 T A 2: 24,443,189 probably benign Het
Pcsk6 A C 7: 65,931,732 I254L possibly damaging Het
Pde3a A G 6: 141,459,216 K389R probably benign Het
Rab3gap1 C A 1: 127,925,259 probably benign Het
Rbck1 G A 2: 152,318,733 Q428* probably null Het
Rptor A G 11: 119,798,840 D321G probably null Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Sdccag3 C A 2: 26,388,897 probably benign Het
Skp1a T C 11: 52,243,619 I59T possibly damaging Het
Slc23a3 T G 1: 75,128,556 N456T probably damaging Het
Slc4a7 G A 14: 14,778,850 G920S probably damaging Het
Smarcd3 T C 5: 24,592,804 I467V probably benign Het
Spata31d1c C T 13: 65,036,060 A472V probably damaging Het
Srsf6 T C 2: 162,931,723 I18T probably damaging Het
Stom C T 2: 35,323,746 G80D probably damaging Het
Svep1 A T 4: 58,084,028 Y1915N possibly damaging Het
Tmf1 C T 6: 97,173,400 V449I probably benign Het
Triobp C T 15: 78,967,095 A483V probably benign Het
Vdac1 G A 11: 52,374,972 probably null Het
Vmn2r75 T G 7: 86,166,286 E123D probably benign Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Zdbf2 T G 1: 63,306,591 N1376K possibly damaging Het
Other mutations in Cyp2b19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Cyp2b19 APN 7 26763461 missense possibly damaging 0.91
IGL01338:Cyp2b19 APN 7 26759417 missense probably benign 0.09
IGL01374:Cyp2b19 APN 7 26759079 missense probably benign 0.06
IGL01613:Cyp2b19 APN 7 26763461 missense possibly damaging 0.91
IGL01695:Cyp2b19 APN 7 26759064 missense probably damaging 1.00
IGL02322:Cyp2b19 APN 7 26762378 missense possibly damaging 0.79
IGL03077:Cyp2b19 APN 7 26762384 missense probably benign
R0047:Cyp2b19 UTSW 7 26766826 missense probably benign 0.01
R0047:Cyp2b19 UTSW 7 26766826 missense probably benign 0.01
R0452:Cyp2b19 UTSW 7 26766762 missense probably benign 0.01
R0865:Cyp2b19 UTSW 7 26762229 splice site probably benign
R1514:Cyp2b19 UTSW 7 26767160 missense probably benign 0.00
R1681:Cyp2b19 UTSW 7 26763340 splice site probably null
R2362:Cyp2b19 UTSW 7 26764377 missense probably damaging 1.00
R4015:Cyp2b19 UTSW 7 26762343 missense probably damaging 1.00
R4259:Cyp2b19 UTSW 7 26763382 missense probably damaging 1.00
R4705:Cyp2b19 UTSW 7 26757292 missense probably benign 0.03
R4789:Cyp2b19 UTSW 7 26764376 missense probably benign 0.16
R5481:Cyp2b19 UTSW 7 26766821 missense probably damaging 0.99
R5749:Cyp2b19 UTSW 7 26763419 missense possibly damaging 0.84
R6041:Cyp2b19 UTSW 7 26759427 missense probably damaging 1.00
R6170:Cyp2b19 UTSW 7 26759094 missense possibly damaging 0.80
R6259:Cyp2b19 UTSW 7 26771392 missense possibly damaging 0.91
R6370:Cyp2b19 UTSW 7 26763358 missense probably benign 0.07
R6519:Cyp2b19 UTSW 7 26759111 missense probably benign
R6656:Cyp2b19 UTSW 7 26766855 missense probably benign
R7283:Cyp2b19 UTSW 7 26766914 missense probably damaging 1.00
R7583:Cyp2b19 UTSW 7 26759064 missense probably damaging 1.00
R7686:Cyp2b19 UTSW 7 26762343 missense probably damaging 1.00
R7732:Cyp2b19 UTSW 7 26771344 missense possibly damaging 0.67
R7831:Cyp2b19 UTSW 7 26767140 missense possibly damaging 0.80
R8035:Cyp2b19 UTSW 7 26771250 missense probably damaging 1.00
R8853:Cyp2b19 UTSW 7 26757220 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- CTTTGTGCCCACAGGAAAGC -3'
(R):5'- CATGGAGTCTAGATTGCTCTGGC -3'

Sequencing Primer
(F):5'- CACAGGAAAGCGCATTTGTCTTG -3'
(R):5'- CTCTGGCAAGTAGGGACTATGACTG -3'
Posted On2015-09-24