Incidental Mutation 'R4592:Cyp2b19'
ID 342897
Institutional Source Beutler Lab
Gene Symbol Cyp2b19
Ensembl Gene ENSMUSG00000066704
Gene Name cytochrome P450, family 2, subfamily b, polypeptide 19
Synonyms
MMRRC Submission 041808-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R4592 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 26456567-26472055 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 26470819 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 487 (I487V)
Ref Sequence ENSEMBL: ENSMUSP00000077021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077855]
AlphaFold O55071
Predicted Effect probably benign
Transcript: ENSMUST00000077855
AA Change: I487V

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000077021
Gene: ENSMUSG00000066704
AA Change: I487V

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:p450 32 489 8.7e-151 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138018
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T A 4: 62,457,164 (GRCm39) V161E possibly damaging Het
Arhgap40 T C 2: 158,388,629 (GRCm39) V521A possibly damaging Het
Atrn T C 2: 130,841,050 (GRCm39) probably benign Het
Casp12 T C 9: 5,352,923 (GRCm39) probably benign Het
Cenpf G A 1: 189,411,230 (GRCm39) T318M probably damaging Het
Cfap119 C T 7: 127,184,663 (GRCm39) R172H probably benign Het
Clcn2 T C 16: 20,527,892 (GRCm39) K525E probably damaging Het
Cntln A G 4: 84,889,419 (GRCm39) T301A probably benign Het
Crat T C 2: 30,305,378 (GRCm39) probably benign Het
Cul5 A G 9: 53,545,027 (GRCm39) probably benign Het
Cxcl14 A T 13: 56,443,708 (GRCm39) I34N probably damaging Het
Cyp4a10 T A 4: 115,386,690 (GRCm39) F446I probably damaging Het
D430041D05Rik T A 2: 104,063,824 (GRCm39) M659L possibly damaging Het
Dclk3 T C 9: 111,296,963 (GRCm39) F169S probably damaging Het
Ddx52 T C 11: 83,848,306 (GRCm39) I532T probably damaging Het
Dnm1 T C 2: 32,226,023 (GRCm39) D352G probably damaging Het
Eif4g2 T C 7: 110,677,509 (GRCm39) E174G probably damaging Het
Enpp6 G T 8: 47,546,067 (GRCm39) V386L probably damaging Het
Entr1 C A 2: 26,278,909 (GRCm39) probably benign Het
Eps15l1 T C 8: 73,095,238 (GRCm39) D904G probably damaging Het
Esrrb A G 12: 86,565,604 (GRCm39) Y356C probably damaging Het
Flt3 A T 5: 147,291,509 (GRCm39) S619T possibly damaging Het
Fndc7 A T 3: 108,766,218 (GRCm39) C716S probably damaging Het
Gm26996 T A 6: 130,556,448 (GRCm39) noncoding transcript Het
Grik2 A T 10: 49,298,711 (GRCm39) F50I possibly damaging Het
Guf1 T C 5: 69,723,786 (GRCm39) V367A possibly damaging Het
Hspg2 C T 4: 137,246,251 (GRCm39) R1010C probably damaging Het
Ifnar2 T C 16: 91,188,684 (GRCm39) V55A probably benign Het
Impg1 T A 9: 80,322,907 (GRCm39) I33F probably benign Het
Ltbp4 A C 7: 27,024,608 (GRCm39) V674G probably damaging Het
Mroh2b T A 15: 4,947,772 (GRCm39) L529H probably damaging Het
Negr1 T C 3: 156,914,023 (GRCm39) probably benign Het
Neurog3 A G 10: 61,969,599 (GRCm39) T25A probably damaging Het
Or10v1 T C 19: 11,874,126 (GRCm39) V247A probably benign Het
Or4a69 T A 2: 89,313,100 (GRCm39) K126N probably damaging Het
Or51h1 A C 7: 102,308,685 (GRCm39) Y219S probably damaging Het
Or5k17 T C 16: 58,746,455 (GRCm39) T160A probably benign Het
Pax8 T A 2: 24,333,201 (GRCm39) probably benign Het
Pcsk6 A C 7: 65,581,480 (GRCm39) I254L possibly damaging Het
Pde3a A G 6: 141,404,942 (GRCm39) K389R probably benign Het
Rab3gap1 C A 1: 127,852,996 (GRCm39) probably benign Het
Rbck1 G A 2: 152,160,653 (GRCm39) Q428* probably null Het
Rptor A G 11: 119,689,666 (GRCm39) D321G probably null Het
Sall2 C A 14: 52,551,260 (GRCm39) R643L probably damaging Het
Skp1 T C 11: 52,134,446 (GRCm39) I59T possibly damaging Het
Slc23a3 T G 1: 75,105,200 (GRCm39) N456T probably damaging Het
Slc4a7 G A 14: 14,778,850 (GRCm38) G920S probably damaging Het
Smarcd3 T C 5: 24,797,802 (GRCm39) I467V probably benign Het
Spata31d1c C T 13: 65,183,874 (GRCm39) A472V probably damaging Het
Spmap1 A G 11: 97,662,441 (GRCm39) S144P probably damaging Het
Srsf6 T C 2: 162,773,643 (GRCm39) I18T probably damaging Het
Stom C T 2: 35,213,758 (GRCm39) G80D probably damaging Het
Svep1 A T 4: 58,084,028 (GRCm39) Y1915N possibly damaging Het
Tmf1 C T 6: 97,150,361 (GRCm39) V449I probably benign Het
Triobp C T 15: 78,851,295 (GRCm39) A483V probably benign Het
Vdac1 G A 11: 52,265,799 (GRCm39) probably null Het
Vmn2r75 T G 7: 85,815,494 (GRCm39) E123D probably benign Het
Vmn2r79 T A 7: 86,653,319 (GRCm39) V528D possibly damaging Het
Zdbf2 T G 1: 63,345,750 (GRCm39) N1376K possibly damaging Het
Zeb1os1 T C 18: 5,525,375 (GRCm39) noncoding transcript Het
Other mutations in Cyp2b19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Cyp2b19 APN 7 26,462,886 (GRCm39) missense possibly damaging 0.91
IGL01338:Cyp2b19 APN 7 26,458,842 (GRCm39) missense probably benign 0.09
IGL01374:Cyp2b19 APN 7 26,458,504 (GRCm39) missense probably benign 0.06
IGL01613:Cyp2b19 APN 7 26,462,886 (GRCm39) missense possibly damaging 0.91
IGL01695:Cyp2b19 APN 7 26,458,489 (GRCm39) missense probably damaging 1.00
IGL02322:Cyp2b19 APN 7 26,461,803 (GRCm39) missense possibly damaging 0.79
IGL03077:Cyp2b19 APN 7 26,461,809 (GRCm39) missense probably benign
R0047:Cyp2b19 UTSW 7 26,466,251 (GRCm39) missense probably benign 0.01
R0047:Cyp2b19 UTSW 7 26,466,251 (GRCm39) missense probably benign 0.01
R0452:Cyp2b19 UTSW 7 26,466,187 (GRCm39) missense probably benign 0.01
R0865:Cyp2b19 UTSW 7 26,461,654 (GRCm39) splice site probably benign
R1514:Cyp2b19 UTSW 7 26,466,585 (GRCm39) missense probably benign 0.00
R1681:Cyp2b19 UTSW 7 26,462,765 (GRCm39) splice site probably null
R2362:Cyp2b19 UTSW 7 26,463,802 (GRCm39) missense probably damaging 1.00
R4015:Cyp2b19 UTSW 7 26,461,768 (GRCm39) missense probably damaging 1.00
R4259:Cyp2b19 UTSW 7 26,462,807 (GRCm39) missense probably damaging 1.00
R4705:Cyp2b19 UTSW 7 26,456,717 (GRCm39) missense probably benign 0.03
R4789:Cyp2b19 UTSW 7 26,463,801 (GRCm39) missense probably benign 0.16
R5481:Cyp2b19 UTSW 7 26,466,246 (GRCm39) missense probably damaging 0.99
R5749:Cyp2b19 UTSW 7 26,462,844 (GRCm39) missense possibly damaging 0.84
R6041:Cyp2b19 UTSW 7 26,458,852 (GRCm39) missense probably damaging 1.00
R6170:Cyp2b19 UTSW 7 26,458,519 (GRCm39) missense possibly damaging 0.80
R6259:Cyp2b19 UTSW 7 26,470,817 (GRCm39) missense possibly damaging 0.91
R6370:Cyp2b19 UTSW 7 26,462,783 (GRCm39) missense probably benign 0.07
R6519:Cyp2b19 UTSW 7 26,458,536 (GRCm39) missense probably benign
R6656:Cyp2b19 UTSW 7 26,466,280 (GRCm39) missense probably benign
R7283:Cyp2b19 UTSW 7 26,466,339 (GRCm39) missense probably damaging 1.00
R7583:Cyp2b19 UTSW 7 26,458,489 (GRCm39) missense probably damaging 1.00
R7686:Cyp2b19 UTSW 7 26,461,768 (GRCm39) missense probably damaging 1.00
R7732:Cyp2b19 UTSW 7 26,470,769 (GRCm39) missense possibly damaging 0.67
R7831:Cyp2b19 UTSW 7 26,466,565 (GRCm39) missense possibly damaging 0.80
R8035:Cyp2b19 UTSW 7 26,470,675 (GRCm39) missense probably damaging 1.00
R8853:Cyp2b19 UTSW 7 26,456,645 (GRCm39) missense possibly damaging 0.53
R9574:Cyp2b19 UTSW 7 26,466,353 (GRCm39) missense probably null 1.00
R9574:Cyp2b19 UTSW 7 26,466,352 (GRCm39) missense probably damaging 1.00
R9650:Cyp2b19 UTSW 7 26,466,208 (GRCm39) missense possibly damaging 0.85
R9681:Cyp2b19 UTSW 7 26,466,328 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTTGTGCCCACAGGAAAGC -3'
(R):5'- CATGGAGTCTAGATTGCTCTGGC -3'

Sequencing Primer
(F):5'- CACAGGAAAGCGCATTTGTCTTG -3'
(R):5'- CTCTGGCAAGTAGGGACTATGACTG -3'
Posted On 2015-09-24