Mutagenetix > Incidental Mutations

Incidental Mutation 'R4592:Ltbp4'

342898

Institutional Source

Beutler Lab

Gene Symbol

Ltbp4

Ensembl Gene

ENSMUSG00000040488

Gene Name

latent transforming growth factor beta binding protein 4

Synonyms

2310046A13Rik

MMRRC Submission

041808-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4592 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

27305136-27337692 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 27325183 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glycine at position 674 (V674G)

Ref Sequence

ENSEMBL: ENSMUSP00000113523 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038618] [ENSMUST00000108369] [ENSMUST00000118583] [ENSMUST00000118961] [ENSMUST00000121175]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000038618
AA Change: V740G

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000037536
Gene: ENSMUSG00000040488
AA Change: V740G

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
low complexity region	87	100	N/A	INTRINSIC
low complexity region	112	125	N/A	INTRINSIC
EGF	151	180	2.74e-3	SMART
low complexity region	244	265	N/A	INTRINSIC
EGF_CA	356	396	3.51e-10	SMART
Pfam:TB	416	457	4.8e-15	PFAM
low complexity region	490	501	N/A	INTRINSIC
low complexity region	507	568	N/A	INTRINSIC
low complexity region	579	590	N/A	INTRINSIC
EGF	591	629	6.06e-5	SMART
EGF_CA	630	671	8.3e-12	SMART
EGF_CA	672	713	7.34e-13	SMART
EGF_CA	714	751	8.43e-13	SMART
EGF_CA	753	794	1.66e-11	SMART
EGF_CA	795	836	3.61e-12	SMART
EGF_CA	837	876	5.61e-9	SMART
EGF_CA	877	919	1.73e-9	SMART
EGF_CA	920	961	7.12e-11	SMART
EGF_CA	962	1002	3.56e-11	SMART
EGF_CA	1003	1046	1.61e-9	SMART
EGF_CA	1047	1090	2.13e-9	SMART
EGF_CA	1091	1132	1.02e-11	SMART
EGF	1136	1175	1.69e1	SMART
low complexity region	1185	1223	N/A	INTRINSIC
Pfam:TB	1234	1276	1.7e-13	PFAM
EGF_CA	1295	1337	2.72e-7	SMART
EGF_CA	1338	1379	1.36e-7	SMART
Pfam:TB	1402	1443	4.3e-14	PFAM
low complexity region	1449	1461	N/A	INTRINSIC
low complexity region	1478	1500	N/A	INTRINSIC
EGF	1578	1615	6.06e-5	SMART
EGF_CA	1616	1660	9.54e-12	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000108369
AA Change: V739G

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000104006
Gene: ENSMUSG00000040488
AA Change: V739G

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
low complexity region	116	145	N/A	INTRINSIC
EGF	150	179	2.74e-3	SMART
low complexity region	243	264	N/A	INTRINSIC
EGF_CA	355	395	3.51e-10	SMART
Pfam:TB	414	456	2.5e-14	PFAM
low complexity region	489	500	N/A	INTRINSIC
low complexity region	506	567	N/A	INTRINSIC
low complexity region	578	589	N/A	INTRINSIC
EGF	590	628	6.06e-5	SMART
EGF_CA	629	670	8.3e-12	SMART
EGF_CA	671	712	7.34e-13	SMART
EGF_CA	713	750	8.43e-13	SMART
EGF_CA	752	793	1.66e-11	SMART
EGF_CA	794	835	3.61e-12	SMART
EGF_CA	836	875	5.61e-9	SMART
EGF_CA	876	918	1.73e-9	SMART
EGF_CA	919	960	7.12e-11	SMART
EGF_CA	961	1001	3.56e-11	SMART
EGF_CA	1002	1045	1.61e-9	SMART
EGF_CA	1046	1089	2.13e-9	SMART
EGF_CA	1090	1131	1.02e-11	SMART
EGF	1135	1174	1.69e1	SMART
low complexity region	1184	1222	N/A	INTRINSIC
Pfam:TB	1232	1275	2.4e-13	PFAM
EGF_CA	1294	1336	2.72e-7	SMART
EGF_CA	1337	1378	1.36e-7	SMART
Pfam:TB	1400	1442	7.6e-15	PFAM
low complexity region	1448	1460	N/A	INTRINSIC
low complexity region	1477	1499	N/A	INTRINSIC
EGF	1577	1614	6.06e-5	SMART
EGF_CA	1615	1659	9.54e-12	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000118583
AA Change: V674G

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000113523
Gene: ENSMUSG00000040488
AA Change: V674G

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	69	80	N/A	INTRINSIC
EGF	85	114	2.74e-3	SMART
low complexity region	178	199	N/A	INTRINSIC
EGF_CA	290	330	3.51e-10	SMART
Pfam:TB	349	391	2.3e-14	PFAM
low complexity region	424	435	N/A	INTRINSIC
low complexity region	441	502	N/A	INTRINSIC
low complexity region	513	524	N/A	INTRINSIC
EGF	525	563	6.06e-5	SMART
EGF_CA	564	605	8.3e-12	SMART
EGF_CA	606	647	7.34e-13	SMART
EGF_CA	648	685	8.43e-13	SMART
EGF_CA	687	728	1.66e-11	SMART
EGF_CA	729	770	3.61e-12	SMART
EGF_CA	771	810	5.61e-9	SMART
EGF_CA	811	853	1.73e-9	SMART
EGF_CA	854	895	7.12e-11	SMART
EGF_CA	896	936	3.56e-11	SMART
EGF_CA	937	980	1.61e-9	SMART
EGF_CA	981	1024	2.13e-9	SMART
EGF_CA	1025	1066	1.02e-11	SMART
EGF	1070	1109	1.69e1	SMART
low complexity region	1119	1157	N/A	INTRINSIC
Pfam:TB	1167	1210	2.2e-13	PFAM
EGF_CA	1229	1271	2.72e-7	SMART
EGF_CA	1272	1313	1.36e-7	SMART
Pfam:TB	1335	1377	7.1e-15	PFAM
low complexity region	1383	1395	N/A	INTRINSIC
low complexity region	1412	1434	N/A	INTRINSIC
EGF	1512	1549	6.06e-5	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000118961
AA Change: V674G

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000113746
Gene: ENSMUSG00000040488
AA Change: V674G

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	69	80	N/A	INTRINSIC
EGF	85	114	2.74e-3	SMART
low complexity region	178	199	N/A	INTRINSIC
EGF_CA	290	330	3.51e-10	SMART
Pfam:TB	349	391	1.6e-14	PFAM
low complexity region	424	435	N/A	INTRINSIC
low complexity region	441	502	N/A	INTRINSIC
low complexity region	513	524	N/A	INTRINSIC
EGF	525	563	6.06e-5	SMART
EGF_CA	564	605	8.3e-12	SMART
EGF_CA	606	647	7.34e-13	SMART
EGF_CA	648	685	8.43e-13	SMART
EGF_CA	687	728	1.66e-11	SMART
EGF_CA	729	770	3.61e-12	SMART
EGF_CA	771	810	5.61e-9	SMART
EGF_CA	811	853	1.73e-9	SMART
EGF_CA	854	895	7.12e-11	SMART
EGF_CA	896	936	3.56e-11	SMART
EGF_CA	937	980	1.61e-9	SMART
EGF_CA	981	1024	2.13e-9	SMART
EGF_CA	1025	1066	1.02e-11	SMART
EGF	1070	1109	1.69e1	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000121175
AA Change: V674G

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000113674
Gene: ENSMUSG00000040488
AA Change: V674G

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	69	80	N/A	INTRINSIC
EGF	85	114	2.74e-3	SMART
low complexity region	178	199	N/A	INTRINSIC
EGF_CA	290	330	3.51e-10	SMART
Pfam:TB	349	391	3.4e-14	PFAM
low complexity region	424	435	N/A	INTRINSIC
low complexity region	441	502	N/A	INTRINSIC
low complexity region	513	524	N/A	INTRINSIC
EGF	525	563	6.06e-5	SMART
EGF_CA	564	605	8.3e-12	SMART
EGF_CA	606	647	7.34e-13	SMART
EGF_CA	648	685	8.43e-13	SMART
EGF_CA	687	728	1.66e-11	SMART
EGF_CA	729	770	3.61e-12	SMART
EGF_CA	771	810	5.61e-9	SMART
EGF_CA	811	853	1.73e-9	SMART
EGF_CA	854	895	7.12e-11	SMART
EGF_CA	896	936	3.56e-11	SMART
EGF_CA	937	980	1.61e-9	SMART
EGF_CA	981	1024	2.13e-9	SMART
EGF_CA	1025	1066	1.02e-11	SMART
EGF	1070	1109	1.69e1	SMART
low complexity region	1119	1157	N/A	INTRINSIC
Pfam:TB	1167	1210	3.3e-13	PFAM
EGF_CA	1229	1271	2.72e-7	SMART
EGF_CA	1272	1313	1.36e-7	SMART
Pfam:TB	1335	1377	1e-14	PFAM
low complexity region	1383	1395	N/A	INTRINSIC
low complexity region	1412	1434	N/A	INTRINSIC
EGF	1512	1549	6.06e-5	SMART
EGF_CA	1550	1594	9.54e-12	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206413

Meta Mutation Damage Score

0.2582

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (64/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds transforming growth factor beta (TGFB) as it is secreted and targeted to the extracellular matrix. TGFB is biologically latent after secretion and insertion into the extracellular matrix, and sheds TGFB and other proteins upon activation. Defects in this gene may be a cause of cutis laxa and severe pulmonary, gastrointestinal, and urinary abnormalities. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, May 2010]
PHENOTYPE: Homozygous disruption of this locus results in pulmonary emphysema, cardiomyopathy, and colon cancer. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001P01Rik	A	G	11: 97,771,615	S144P	probably damaging	Het
4933430I17Rik	T	A	4: 62,538,927	V161E	possibly damaging	Het
Arhgap40	T	C	2: 158,546,709	V521A	possibly damaging	Het
Atrn	T	C	2: 130,999,130		probably benign	Het
Casp12	T	C	9: 5,352,923		probably benign	Het
Ccdc189	C	T	7: 127,585,491	R172H	probably benign	Het
Cenpf	G	A	1: 189,679,033	T318M	probably damaging	Het
Clcn2	T	C	16: 20,709,142	K525E	probably damaging	Het
Cntln	A	G	4: 84,971,182	T301A	probably benign	Het
Crat	T	C	2: 30,415,366		probably benign	Het
Cul5	A	G	9: 53,633,727		probably benign	Het
Cxcl14	A	T	13: 56,295,895	I34N	probably damaging	Het
Cyp2b19	A	G	7: 26,771,394	I487V	probably benign	Het
Cyp4a10	T	A	4: 115,529,493	F446I	probably damaging	Het
D430041D05Rik	T	A	2: 104,233,479	M659L	possibly damaging	Het
Dclk3	T	C	9: 111,467,895	F169S	probably damaging	Het
Ddx52	T	C	11: 83,957,480	I532T	probably damaging	Het
Dnm1	T	C	2: 32,336,011	D352G	probably damaging	Het
Eif4g2	T	C	7: 111,078,302	E174G	probably damaging	Het
Enpp6	G	T	8: 47,093,032	V386L	probably damaging	Het
Eps15l1	T	C	8: 72,341,394	D904G	probably damaging	Het
Esrrb	A	G	12: 86,518,830	Y356C	probably damaging	Het
Flt3	A	T	5: 147,354,699	S619T	possibly damaging	Het
Fndc7	A	T	3: 108,858,902	C716S	probably damaging	Het
Gm10125	T	C	18: 5,525,375		noncoding transcript	Het
Gm26996	T	A	6: 130,579,485		noncoding transcript	Het
Grik2	A	T	10: 49,422,615	F50I	possibly damaging	Het
Guf1	T	C	5: 69,566,443	V367A	possibly damaging	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Ifnar2	T	C	16: 91,391,796	V55A	probably benign	Het
Impg1	T	A	9: 80,440,854	I33F	probably benign	Het
Mroh2b	T	A	15: 4,918,290	L529H	probably damaging	Het
Negr1	T	C	3: 157,208,386		probably benign	Het
Neurog3	A	G	10: 62,133,820	T25A	probably damaging	Het
Olfr1241	T	A	2: 89,482,756	K126N	probably damaging	Het
Olfr1420	T	C	19: 11,896,762	V247A	probably benign	Het
Olfr181	T	C	16: 58,926,092	T160A	probably benign	Het
Olfr555	A	C	7: 102,659,478	Y219S	probably damaging	Het
Pax8	T	A	2: 24,443,189		probably benign	Het
Pcsk6	A	C	7: 65,931,732	I254L	possibly damaging	Het
Pde3a	A	G	6: 141,459,216	K389R	probably benign	Het
Rab3gap1	C	A	1: 127,925,259		probably benign	Het
Rbck1	G	A	2: 152,318,733	Q428*	probably null	Het
Rptor	A	G	11: 119,798,840	D321G	probably null	Het
Sall2	C	A	14: 52,313,803	R643L	probably damaging	Het
Sdccag3	C	A	2: 26,388,897		probably benign	Het
Skp1a	T	C	11: 52,243,619	I59T	possibly damaging	Het
Slc23a3	T	G	1: 75,128,556	N456T	probably damaging	Het
Slc4a7	G	A	14: 14,778,850	G920S	probably damaging	Het
Smarcd3	T	C	5: 24,592,804	I467V	probably benign	Het
Spata31d1c	C	T	13: 65,036,060	A472V	probably damaging	Het
Srsf6	T	C	2: 162,931,723	I18T	probably damaging	Het
Stom	C	T	2: 35,323,746	G80D	probably damaging	Het
Svep1	A	T	4: 58,084,028	Y1915N	possibly damaging	Het
Tmf1	C	T	6: 97,173,400	V449I	probably benign	Het
Triobp	C	T	15: 78,967,095	A483V	probably benign	Het
Vdac1	G	A	11: 52,374,972		probably null	Het
Vmn2r75	T	G	7: 86,166,286	E123D	probably benign	Het
Vmn2r79	T	A	7: 87,004,111	V528D	possibly damaging	Het
Zdbf2	T	G	1: 63,306,591	N1376K	possibly damaging	Het

Other mutations in Ltbp4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00434:Ltbp4	APN	7	27328805	missense	probably damaging	0.96
IGL00585:Ltbp4	APN	7	27326733	missense	probably damaging	0.98
IGL01320:Ltbp4	APN	7	27328359	splice site	probably benign
IGL01860:Ltbp4	APN	7	27319646	missense	probably damaging	1.00
IGL02026:Ltbp4	APN	7	27327417	nonsense	probably null
IGL02226:Ltbp4	APN	7	27306934	missense	probably damaging	1.00
IGL02422:Ltbp4	APN	7	27319672	missense	probably damaging	1.00
IGL02611:Ltbp4	APN	7	27310655	missense	probably damaging	1.00
IGL02892:Ltbp4	APN	7	27310649	missense	probably damaging	1.00
IGL02926:Ltbp4	APN	7	27328872	splice site	probably null
IGL02950:Ltbp4	APN	7	27306718	missense	probably damaging	0.99
IGL03008:Ltbp4	APN	7	27324364	missense	probably damaging	0.99
IGL03271:Ltbp4	APN	7	27329815	missense	unknown
IGL02837:Ltbp4	UTSW	7	27314381	missense	probably damaging	1.00
R0792:Ltbp4	UTSW	7	27325060	missense	probably damaging	1.00
R0980:Ltbp4	UTSW	7	27324162	missense	probably damaging	1.00
R1017:Ltbp4	UTSW	7	27306076	missense	possibly damaging	0.95
R1185:Ltbp4	UTSW	7	27310535	missense	probably damaging	1.00
R1185:Ltbp4	UTSW	7	27310535	missense	probably damaging	1.00
R1185:Ltbp4	UTSW	7	27310535	missense	probably damaging	1.00
R1403:Ltbp4	UTSW	7	27329039	missense	unknown
R1403:Ltbp4	UTSW	7	27329039	missense	unknown
R1448:Ltbp4	UTSW	7	27306577	missense	possibly damaging	0.86
R1575:Ltbp4	UTSW	7	27322820	missense	probably damaging	1.00
R1918:Ltbp4	UTSW	7	27337569	unclassified	probably benign
R1932:Ltbp4	UTSW	7	27307766	critical splice donor site	probably null
R1959:Ltbp4	UTSW	7	27329018	missense	unknown
R1960:Ltbp4	UTSW	7	27329018	missense	unknown
R1976:Ltbp4	UTSW	7	27326770	missense	probably damaging	1.00
R2060:Ltbp4	UTSW	7	27308953	missense	probably damaging	1.00
R2333:Ltbp4	UTSW	7	27327778	missense	possibly damaging	0.82
R2431:Ltbp4	UTSW	7	27319676	missense	possibly damaging	0.91
R3125:Ltbp4	UTSW	7	27327778	missense	possibly damaging	0.82
R4093:Ltbp4	UTSW	7	27325216	missense	possibly damaging	0.93
R4095:Ltbp4	UTSW	7	27325216	missense	possibly damaging	0.93
R4610:Ltbp4	UTSW	7	27306700	missense	probably damaging	1.00
R4650:Ltbp4	UTSW	7	27314309	missense	probably damaging	1.00
R4912:Ltbp4	UTSW	7	27306116	nonsense	probably null
R5002:Ltbp4	UTSW	7	27327685	frame shift	probably null
R5016:Ltbp4	UTSW	7	27327685	frame shift	probably null
R5216:Ltbp4	UTSW	7	27327311	small deletion	probably benign
R5218:Ltbp4	UTSW	7	27327311	small deletion	probably benign
R5219:Ltbp4	UTSW	7	27327311	small deletion	probably benign
R5219:Ltbp4	UTSW	7	27327321	missense	probably benign	0.01
R5539:Ltbp4	UTSW	7	27327724	missense	probably damaging	0.97
R5991:Ltbp4	UTSW	7	27309316	missense	probably damaging	1.00
R6082:Ltbp4	UTSW	7	27335680	unclassified	probably benign
R6125:Ltbp4	UTSW	7	27327755	missense	probably damaging	1.00
R6146:Ltbp4	UTSW	7	27319724	missense	probably damaging	0.99
R6156:Ltbp4	UTSW	7	27330162	missense	unknown
R6414:Ltbp4	UTSW	7	27310715	missense	probably damaging	1.00
R6563:Ltbp4	UTSW	7	27309063	missense	probably damaging	1.00
R6719:Ltbp4	UTSW	7	27328763	missense	probably damaging	0.99
R6940:Ltbp4	UTSW	7	27308944	missense	probably damaging	1.00
R7054:Ltbp4	UTSW	7	27307766	critical splice donor site	probably null
R7116:Ltbp4	UTSW	7	27305427	missense	probably damaging	0.99
R7326:Ltbp4	UTSW	7	27329755	missense	unknown
R7419:Ltbp4	UTSW	7	27329767	missense	unknown
R8068:Ltbp4	UTSW	7	27324168	missense	probably damaging	0.99
R8435:Ltbp4	UTSW	7	27335445	missense	unknown
R8543:Ltbp4	UTSW	7	27325241	missense	possibly damaging	0.84
X0025:Ltbp4	UTSW	7	27325802	missense	probably damaging	1.00
X0066:Ltbp4	UTSW	7	27306065	critical splice donor site	probably null
Z1088:Ltbp4	UTSW	7	27307792	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGCTAGCCATAGTGCTGCAG -3'
(R):5'- CCAGAGTCAGAATGAAGCTCAG -3'

Sequencing Primer
(F):5'- CCATAGTGCTGCAGGCTTG -3'
(R):5'- CTCAGGCAGAATGTAGCATGGTG -3'

Posted On

2015-09-24