Incidental Mutation 'R4592:Pcsk6'
ID342899
Institutional Source Beutler Lab
Gene Symbol Pcsk6
Ensembl Gene ENSMUSG00000030513
Gene Nameproprotein convertase subtilisin/kexin type 6
SynonymsPACE4, SPC4
MMRRC Submission 041808-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R4592 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location65861734-66050386 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 65931732 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 254 (I254L)
Ref Sequence ENSEMBL: ENSMUSP00000053742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055576] [ENSMUST00000098391] [ENSMUST00000176199] [ENSMUST00000176209]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055576
AA Change: I254L

PolyPhen 2 Score 0.541 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000053742
Gene: ENSMUSG00000030513
AA Change: I254L

DomainStartEndE-ValueType
signal peptide 1 54 N/A INTRINSIC
Pfam:S8_pro-domain 65 141 3.1e-29 PFAM
Pfam:Peptidase_S8 186 469 5.2e-49 PFAM
Pfam:P_proprotein 529 619 9.7e-37 PFAM
FU 682 729 5.87e-11 SMART
EGF_like 688 737 5.03e1 SMART
FU 733 780 4.35e-14 SMART
EGF_like 738 771 3.57e1 SMART
FU 784 828 2.08e-11 SMART
EGF 789 819 2.48e1 SMART
FU 832 877 9.4e-10 SMART
EGF_like 837 868 6.28e1 SMART
FU 885 933 8.58e-4 SMART
EGF 890 920 1.69e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098391
AA Change: I254L

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000095992
Gene: ENSMUSG00000030513
AA Change: I254L

DomainStartEndE-ValueType
signal peptide 1 54 N/A INTRINSIC
PDB:1KN6|A 62 129 2e-6 PDB
low complexity region 131 144 N/A INTRINSIC
Pfam:Peptidase_S8 190 478 1.1e-58 PFAM
Pfam:P_proprotein 529 619 4.5e-37 PFAM
FU 669 716 3.87e-11 SMART
EGF_like 675 724 5.03e1 SMART
FU 720 767 4.35e-14 SMART
EGF_like 725 758 3.57e1 SMART
FU 771 815 2.08e-11 SMART
EGF 776 806 2.48e1 SMART
FU 819 864 9.4e-10 SMART
EGF_like 824 855 6.28e1 SMART
FU 872 920 8.58e-4 SMART
EGF 877 907 1.69e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176199
AA Change: I132L

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135851
Gene: ENSMUSG00000030513
AA Change: I132L

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
Pfam:Peptidase_S8 68 160 1.3e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000176209
AA Change: I167L

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000135033
Gene: ENSMUSG00000030513
AA Change: I167L

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
Pfam:Peptidase_S8 103 372 6.5e-50 PFAM
Pfam:P_proprotein 368 458 6.2e-37 PFAM
FU 521 568 5.87e-11 SMART
EGF_like 527 576 5.03e1 SMART
FU 572 619 4.35e-14 SMART
EGF_like 577 610 3.57e1 SMART
FU 623 667 2.08e-11 SMART
EGF 628 658 2.48e1 SMART
FU 671 716 9.4e-10 SMART
EGF_like 676 707 6.28e1 SMART
FU 724 772 8.58e-4 SMART
EGF 729 759 1.69e1 SMART
Meta Mutation Damage Score 0.3187 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an initial autocatalytic processing event in the ER to generate a heterodimer which exits the ER and sorts to the trans-Golgi network where a second autocatalytic event takes place and the catalytic activity is acquired. The encoded protease is constitutively secreted into the extracellular matrix and expressed in many tissues, including neuroendocrine, liver, gut, and brain. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. Some of its substrates include transforming growth factor beta related proteins, proalbumin, and von Willebrand factor. This gene is thought to play a role in tumor progression and left-right patterning. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutation of this gene results in partial lethality by E15.5. Embryos develop situs ambiguus with left pulmonary isomerism or craniofacial malformations including cyclopia, or both. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik A G 11: 97,771,615 S144P probably damaging Het
4933430I17Rik T A 4: 62,538,927 V161E possibly damaging Het
Arhgap40 T C 2: 158,546,709 V521A possibly damaging Het
Atrn T C 2: 130,999,130 probably benign Het
Casp12 T C 9: 5,352,923 probably benign Het
Ccdc189 C T 7: 127,585,491 R172H probably benign Het
Cenpf G A 1: 189,679,033 T318M probably damaging Het
Clcn2 T C 16: 20,709,142 K525E probably damaging Het
Cntln A G 4: 84,971,182 T301A probably benign Het
Crat T C 2: 30,415,366 probably benign Het
Cul5 A G 9: 53,633,727 probably benign Het
Cxcl14 A T 13: 56,295,895 I34N probably damaging Het
Cyp2b19 A G 7: 26,771,394 I487V probably benign Het
Cyp4a10 T A 4: 115,529,493 F446I probably damaging Het
D430041D05Rik T A 2: 104,233,479 M659L possibly damaging Het
Dclk3 T C 9: 111,467,895 F169S probably damaging Het
Ddx52 T C 11: 83,957,480 I532T probably damaging Het
Dnm1 T C 2: 32,336,011 D352G probably damaging Het
Eif4g2 T C 7: 111,078,302 E174G probably damaging Het
Enpp6 G T 8: 47,093,032 V386L probably damaging Het
Eps15l1 T C 8: 72,341,394 D904G probably damaging Het
Esrrb A G 12: 86,518,830 Y356C probably damaging Het
Flt3 A T 5: 147,354,699 S619T possibly damaging Het
Fndc7 A T 3: 108,858,902 C716S probably damaging Het
Gm10125 T C 18: 5,525,375 noncoding transcript Het
Gm26996 T A 6: 130,579,485 noncoding transcript Het
Grik2 A T 10: 49,422,615 F50I possibly damaging Het
Guf1 T C 5: 69,566,443 V367A possibly damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ifnar2 T C 16: 91,391,796 V55A probably benign Het
Impg1 T A 9: 80,440,854 I33F probably benign Het
Ltbp4 A C 7: 27,325,183 V674G probably damaging Het
Mroh2b T A 15: 4,918,290 L529H probably damaging Het
Negr1 T C 3: 157,208,386 probably benign Het
Neurog3 A G 10: 62,133,820 T25A probably damaging Het
Olfr1241 T A 2: 89,482,756 K126N probably damaging Het
Olfr1420 T C 19: 11,896,762 V247A probably benign Het
Olfr181 T C 16: 58,926,092 T160A probably benign Het
Olfr555 A C 7: 102,659,478 Y219S probably damaging Het
Pax8 T A 2: 24,443,189 probably benign Het
Pde3a A G 6: 141,459,216 K389R probably benign Het
Rab3gap1 C A 1: 127,925,259 probably benign Het
Rbck1 G A 2: 152,318,733 Q428* probably null Het
Rptor A G 11: 119,798,840 D321G probably null Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Sdccag3 C A 2: 26,388,897 probably benign Het
Skp1a T C 11: 52,243,619 I59T possibly damaging Het
Slc23a3 T G 1: 75,128,556 N456T probably damaging Het
Slc4a7 G A 14: 14,778,850 G920S probably damaging Het
Smarcd3 T C 5: 24,592,804 I467V probably benign Het
Spata31d1c C T 13: 65,036,060 A472V probably damaging Het
Srsf6 T C 2: 162,931,723 I18T probably damaging Het
Stom C T 2: 35,323,746 G80D probably damaging Het
Svep1 A T 4: 58,084,028 Y1915N possibly damaging Het
Tmf1 C T 6: 97,173,400 V449I probably benign Het
Triobp C T 15: 78,967,095 A483V probably benign Het
Vdac1 G A 11: 52,374,972 probably null Het
Vmn2r75 T G 7: 86,166,286 E123D probably benign Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Zdbf2 T G 1: 63,306,591 N1376K possibly damaging Het
Other mutations in Pcsk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Pcsk6 APN 7 65927820 missense probably damaging 1.00
IGL01609:Pcsk6 APN 7 66035273 splice site probably null
IGL01986:Pcsk6 APN 7 65927877 missense probably damaging 1.00
IGL02592:Pcsk6 APN 7 65969028 missense probably damaging 1.00
IGL02720:Pcsk6 APN 7 65980247 nonsense probably null
R0045:Pcsk6 UTSW 7 65962928 missense probably damaging 1.00
R0045:Pcsk6 UTSW 7 65962928 missense probably damaging 1.00
R0053:Pcsk6 UTSW 7 65983703 splice site probably benign
R0053:Pcsk6 UTSW 7 65983703 splice site probably benign
R0103:Pcsk6 UTSW 7 65929097 splice site probably benign
R0103:Pcsk6 UTSW 7 65929097 splice site probably benign
R0119:Pcsk6 UTSW 7 66039043 missense probably benign 0.10
R0299:Pcsk6 UTSW 7 66039043 missense probably benign 0.10
R0415:Pcsk6 UTSW 7 66033874 missense probably damaging 1.00
R0496:Pcsk6 UTSW 7 65927249 missense probably benign 0.00
R0518:Pcsk6 UTSW 7 65980167 missense possibly damaging 0.64
R0748:Pcsk6 UTSW 7 66038968 unclassified probably benign
R1456:Pcsk6 UTSW 7 66043535 missense possibly damaging 0.87
R1613:Pcsk6 UTSW 7 65910311 splice site probably benign
R1680:Pcsk6 UTSW 7 66035250 missense probably benign 0.14
R1682:Pcsk6 UTSW 7 65910228 missense probably damaging 1.00
R1987:Pcsk6 UTSW 7 65927287 missense possibly damaging 0.60
R4191:Pcsk6 UTSW 7 66025308 missense probably damaging 0.98
R4193:Pcsk6 UTSW 7 66025308 missense probably damaging 0.98
R4577:Pcsk6 UTSW 7 65959266 nonsense probably null
R4687:Pcsk6 UTSW 7 65983753 missense probably damaging 1.00
R4697:Pcsk6 UTSW 7 65959241 missense probably damaging 1.00
R4778:Pcsk6 UTSW 7 65959145 missense probably damaging 1.00
R5065:Pcsk6 UTSW 7 65910299 missense possibly damaging 0.84
R5218:Pcsk6 UTSW 7 66025288 missense probably benign 0.01
R5356:Pcsk6 UTSW 7 65970592 missense probably damaging 1.00
R5427:Pcsk6 UTSW 7 66033899 missense probably benign 0.01
R5589:Pcsk6 UTSW 7 65929185 critical splice donor site probably null
R5637:Pcsk6 UTSW 7 65968997 missense probably damaging 1.00
R5888:Pcsk6 UTSW 7 66043624 missense probably null
R5958:Pcsk6 UTSW 7 66043611 missense probably damaging 1.00
R5997:Pcsk6 UTSW 7 65959293 missense probably damaging 1.00
R6191:Pcsk6 UTSW 7 65929127 missense probably benign 0.19
R6274:Pcsk6 UTSW 7 66033844 missense probably damaging 1.00
R6374:Pcsk6 UTSW 7 65980155 missense possibly damaging 0.80
R6393:Pcsk6 UTSW 7 65969014 missense probably damaging 1.00
R6730:Pcsk6 UTSW 7 65980248 missense probably damaging 1.00
R7205:Pcsk6 UTSW 7 66025408 critical splice donor site probably null
R7493:Pcsk6 UTSW 7 66043566 missense possibly damaging 0.53
R7570:Pcsk6 UTSW 7 66033898 missense probably benign 0.03
R7731:Pcsk6 UTSW 7 66033893 missense probably benign 0.00
R7779:Pcsk6 UTSW 7 66025404 missense probably benign 0.03
R8042:Pcsk6 UTSW 7 65927935 missense possibly damaging 0.87
R8734:Pcsk6 UTSW 7 65931733 missense probably benign 0.06
R8805:Pcsk6 UTSW 7 65929143 missense possibly damaging 0.67
Z1177:Pcsk6 UTSW 7 65959113 missense probably damaging 1.00
Z1177:Pcsk6 UTSW 7 66033811 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGCATCTCAGCTATAGGAAGG -3'
(R):5'- AAGCTGCCAGATCAGGGATC -3'

Sequencing Primer
(F):5'- AGGGATAGCTGACCTTGGC -3'
(R):5'- AAACAGTGGGGTCTATCTGCTCAC -3'
Posted On2015-09-24