Incidental Mutation 'R4592:Eif4g2'
ID342903
Institutional Source Beutler Lab
Gene Symbol Eif4g2
Ensembl Gene ENSMUSG00000005610
Gene Nameeukaryotic translation initiation factor 4, gamma 2
SynonymsDAP-5, Nat1, E130105L11Rik, Natm1
MMRRC Submission 041808-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4592 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location111067750-111083030 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111078302 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 174 (E174G)
Ref Sequence ENSEMBL: ENSMUSP00000124551 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159305] [ENSMUST00000160132] [ENSMUST00000160966] [ENSMUST00000161051] [ENSMUST00000162415]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158323
Predicted Effect probably benign
Transcript: ENSMUST00000159305
SMART Domains Protein: ENSMUSP00000125098
Gene: ENSMUSG00000005610

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
Blast:MIF4G 32 83 4e-22 BLAST
SCOP:d1hu3a_ 67 102 9e-13 SMART
PDB:4IUL|B 70 102 3e-15 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159465
Predicted Effect probably benign
Transcript: ENSMUST00000160132
SMART Domains Protein: ENSMUSP00000124914
Gene: ENSMUSG00000005610

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 61 69 N/A INTRINSIC
Pfam:MIF4G 78 152 1.3e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160552
Predicted Effect probably benign
Transcript: ENSMUST00000160966
Predicted Effect probably damaging
Transcript: ENSMUST00000161051
AA Change: E174G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125375
Gene: ENSMUSG00000005610
AA Change: E174G

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 61 69 N/A INTRINSIC
MIF4G 78 308 2.08e-58 SMART
MA3 505 618 4.76e-35 SMART
low complexity region 634 646 N/A INTRINSIC
low complexity region 682 704 N/A INTRINSIC
low complexity region 760 771 N/A INTRINSIC
eIF5C 775 861 5.43e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161158
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161682
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161736
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161790
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162394
Predicted Effect probably damaging
Transcript: ENSMUST00000162415
AA Change: E174G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124551
Gene: ENSMUSG00000005610
AA Change: E174G

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 61 69 N/A INTRINSIC
MIF4G 78 308 2.08e-58 SMART
low complexity region 441 453 N/A INTRINSIC
Blast:MIF4G 454 490 4e-14 BLAST
MA3 543 656 4.76e-35 SMART
low complexity region 672 684 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 798 809 N/A INTRINSIC
eIF5C 813 899 5.43e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163014
SMART Domains Protein: ENSMUSP00000123811
Gene: ENSMUSG00000005610

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
Pfam:W2 52 122 2.2e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209597
Meta Mutation Damage Score 0.6023 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: Translation initiation is mediated by specific recognition of the cap structure by eukaryotic translation initiation factor 4F (eIF4F), which is a cap binding protein complex that consists of three subunits: eIF4A, eIF4E and eIF4G. The protein encoded by this gene shares similarity with the C-terminal region of eIF4G, that contains the binding sites for eIF4A and eIF3; eIF4G in addition, contains a binding site for eIF4E at the N-terminus. Unlike eIF4G which supports cap-dependent and independent translation, this gene product functions as a general repressor of translation by forming translationally inactive complexes. Transgene expression of the apolipoprotein B mRNA-editing enzyme (APOBEC-1) causes extensive editing of this mRNA, which could contribute to the potent oncogenesis induced by overexpression of APOBEC-1. In vitro and in vivo studies in human indicate that translation of this mRNA initiates exclusively at a non-AUG (GUG) codon. This also appears to be true for mouse. Two alternatively spliced transcript variants that encode different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation fail to undergo gastrulation and die by E11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik A G 11: 97,771,615 S144P probably damaging Het
4933430I17Rik T A 4: 62,538,927 V161E possibly damaging Het
Arhgap40 T C 2: 158,546,709 V521A possibly damaging Het
Atrn T C 2: 130,999,130 probably benign Het
Casp12 T C 9: 5,352,923 probably benign Het
Ccdc189 C T 7: 127,585,491 R172H probably benign Het
Cenpf G A 1: 189,679,033 T318M probably damaging Het
Clcn2 T C 16: 20,709,142 K525E probably damaging Het
Cntln A G 4: 84,971,182 T301A probably benign Het
Crat T C 2: 30,415,366 probably benign Het
Cul5 A G 9: 53,633,727 probably benign Het
Cxcl14 A T 13: 56,295,895 I34N probably damaging Het
Cyp2b19 A G 7: 26,771,394 I487V probably benign Het
Cyp4a10 T A 4: 115,529,493 F446I probably damaging Het
D430041D05Rik T A 2: 104,233,479 M659L possibly damaging Het
Dclk3 T C 9: 111,467,895 F169S probably damaging Het
Ddx52 T C 11: 83,957,480 I532T probably damaging Het
Dnm1 T C 2: 32,336,011 D352G probably damaging Het
Enpp6 G T 8: 47,093,032 V386L probably damaging Het
Eps15l1 T C 8: 72,341,394 D904G probably damaging Het
Esrrb A G 12: 86,518,830 Y356C probably damaging Het
Flt3 A T 5: 147,354,699 S619T possibly damaging Het
Fndc7 A T 3: 108,858,902 C716S probably damaging Het
Gm10125 T C 18: 5,525,375 noncoding transcript Het
Gm26996 T A 6: 130,579,485 noncoding transcript Het
Grik2 A T 10: 49,422,615 F50I possibly damaging Het
Guf1 T C 5: 69,566,443 V367A possibly damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ifnar2 T C 16: 91,391,796 V55A probably benign Het
Impg1 T A 9: 80,440,854 I33F probably benign Het
Ltbp4 A C 7: 27,325,183 V674G probably damaging Het
Mroh2b T A 15: 4,918,290 L529H probably damaging Het
Negr1 T C 3: 157,208,386 probably benign Het
Neurog3 A G 10: 62,133,820 T25A probably damaging Het
Olfr1241 T A 2: 89,482,756 K126N probably damaging Het
Olfr1420 T C 19: 11,896,762 V247A probably benign Het
Olfr181 T C 16: 58,926,092 T160A probably benign Het
Olfr555 A C 7: 102,659,478 Y219S probably damaging Het
Pax8 T A 2: 24,443,189 probably benign Het
Pcsk6 A C 7: 65,931,732 I254L possibly damaging Het
Pde3a A G 6: 141,459,216 K389R probably benign Het
Rab3gap1 C A 1: 127,925,259 probably benign Het
Rbck1 G A 2: 152,318,733 Q428* probably null Het
Rptor A G 11: 119,798,840 D321G probably null Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Sdccag3 C A 2: 26,388,897 probably benign Het
Skp1a T C 11: 52,243,619 I59T possibly damaging Het
Slc23a3 T G 1: 75,128,556 N456T probably damaging Het
Slc4a7 G A 14: 14,778,850 G920S probably damaging Het
Smarcd3 T C 5: 24,592,804 I467V probably benign Het
Spata31d1c C T 13: 65,036,060 A472V probably damaging Het
Srsf6 T C 2: 162,931,723 I18T probably damaging Het
Stom C T 2: 35,323,746 G80D probably damaging Het
Svep1 A T 4: 58,084,028 Y1915N possibly damaging Het
Tmf1 C T 6: 97,173,400 V449I probably benign Het
Triobp C T 15: 78,967,095 A483V probably benign Het
Vdac1 G A 11: 52,374,972 probably null Het
Vmn2r75 T G 7: 86,166,286 E123D probably benign Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Zdbf2 T G 1: 63,306,591 N1376K possibly damaging Het
Other mutations in Eif4g2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Eif4g2 APN 7 111074713 missense possibly damaging 0.91
IGL01402:Eif4g2 APN 7 111077027 missense possibly damaging 0.94
IGL02502:Eif4g2 APN 7 111081541 missense probably damaging 0.98
IGL02538:Eif4g2 APN 7 111079316 missense probably benign 0.03
IGL02717:Eif4g2 APN 7 111078113 missense probably benign 0.45
R0547:Eif4g2 UTSW 7 111078293 missense probably damaging 1.00
R0614:Eif4g2 UTSW 7 111077223 critical splice donor site probably null
R1351:Eif4g2 UTSW 7 111074080 missense probably damaging 1.00
R1764:Eif4g2 UTSW 7 111074487 missense probably damaging 1.00
R2009:Eif4g2 UTSW 7 111074198 missense probably benign 0.01
R2318:Eif4g2 UTSW 7 111073858 missense possibly damaging 0.78
R2382:Eif4g2 UTSW 7 111075046 missense probably benign 0.00
R2986:Eif4g2 UTSW 7 111078483 missense probably damaging 0.99
R4012:Eif4g2 UTSW 7 111074151 missense possibly damaging 0.86
R4785:Eif4g2 UTSW 7 111076796 missense probably damaging 0.99
R5037:Eif4g2 UTSW 7 111077032 missense probably benign 0.03
R5627:Eif4g2 UTSW 7 111074239 missense probably benign 0.32
R5988:Eif4g2 UTSW 7 111077230 missense probably benign 0.11
R6229:Eif4g2 UTSW 7 111077713 splice site probably null
R8122:Eif4g2 UTSW 7 111078553 missense possibly damaging 0.93
R8218:Eif4g2 UTSW 7 111074432 missense possibly damaging 0.62
R8711:Eif4g2 UTSW 7 111073920 missense probably damaging 1.00
R8726:Eif4g2 UTSW 7 111077422 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTGCCAAGTTCTCCAATG -3'
(R):5'- AAACTTTGATGGCCCAGCAG -3'

Sequencing Primer
(F):5'- CCCAACATCTTGATCTTAGCAATGG -3'
(R):5'- TTGATGGCCCAGCAGCAGAG -3'
Posted On2015-09-24