Incidental Mutation 'R4592:Ccdc189'
ID342904
Institutional Source Beutler Lab
Gene Symbol Ccdc189
Ensembl Gene ENSMUSG00000057176
Gene Namecoiled-coil domain containing 189
SynonymsLOC233899, Gm166
MMRRC Submission 041808-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4592 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location127582383-127588595 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 127585491 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 172 (R172H)
Ref Sequence ENSEMBL: ENSMUSP00000072019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033086] [ENSMUST00000033088] [ENSMUST00000072155] [ENSMUST00000121004] [ENSMUST00000146383] [ENSMUST00000154891] [ENSMUST00000205633] [ENSMUST00000205694] [ENSMUST00000206914]
Predicted Effect probably benign
Transcript: ENSMUST00000033086
SMART Domains Protein: ENSMUSP00000033086
Gene: ENSMUSG00000030815

DomainStartEndE-ValueType
S_TKc 24 291 6.4e-104 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000033088
SMART Domains Protein: ENSMUSP00000033088
Gene: ENSMUSG00000030816

DomainStartEndE-ValueType
coiled coil region 55 86 N/A INTRINSIC
coiled coil region 189 209 N/A INTRINSIC
coiled coil region 231 377 N/A INTRINSIC
coiled coil region 437 525 N/A INTRINSIC
low complexity region 565 576 N/A INTRINSIC
coiled coil region 629 760 N/A INTRINSIC
coiled coil region 800 839 N/A INTRINSIC
RING 948 986 1.86e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072155
AA Change: R172H

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000072019
Gene: ENSMUSG00000057176
AA Change: R172H

DomainStartEndE-ValueType
Pfam:CLAMP 130 228 3.1e-37 PFAM
low complexity region 243 274 N/A INTRINSIC
coiled coil region 285 319 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121004
SMART Domains Protein: ENSMUSP00000113533
Gene: ENSMUSG00000030815

DomainStartEndE-ValueType
S_TKc 24 291 6.4e-104 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138158
Predicted Effect probably benign
Transcript: ENSMUST00000146383
SMART Domains Protein: ENSMUSP00000115593
Gene: ENSMUSG00000030815

DomainStartEndE-ValueType
Pfam:Pkinase 24 85 8.6e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149853
Predicted Effect probably benign
Transcript: ENSMUST00000154891
SMART Domains Protein: ENSMUSP00000116860
Gene: ENSMUSG00000030815

DomainStartEndE-ValueType
Pfam:Pkinase 24 78 4.5e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205633
Predicted Effect probably benign
Transcript: ENSMUST00000205694
Predicted Effect unknown
Transcript: ENSMUST00000205839
AA Change: R33H
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206057
Predicted Effect probably benign
Transcript: ENSMUST00000206914
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206891
Predicted Effect probably benign
Transcript: ENSMUST00000206818
Meta Mutation Damage Score 0.1548 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik A G 11: 97,771,615 S144P probably damaging Het
4933430I17Rik T A 4: 62,538,927 V161E possibly damaging Het
Arhgap40 T C 2: 158,546,709 V521A possibly damaging Het
Atrn T C 2: 130,999,130 probably benign Het
Casp12 T C 9: 5,352,923 probably benign Het
Cenpf G A 1: 189,679,033 T318M probably damaging Het
Clcn2 T C 16: 20,709,142 K525E probably damaging Het
Cntln A G 4: 84,971,182 T301A probably benign Het
Crat T C 2: 30,415,366 probably benign Het
Cul5 A G 9: 53,633,727 probably benign Het
Cxcl14 A T 13: 56,295,895 I34N probably damaging Het
Cyp2b19 A G 7: 26,771,394 I487V probably benign Het
Cyp4a10 T A 4: 115,529,493 F446I probably damaging Het
D430041D05Rik T A 2: 104,233,479 M659L possibly damaging Het
Dclk3 T C 9: 111,467,895 F169S probably damaging Het
Ddx52 T C 11: 83,957,480 I532T probably damaging Het
Dnm1 T C 2: 32,336,011 D352G probably damaging Het
Eif4g2 T C 7: 111,078,302 E174G probably damaging Het
Enpp6 G T 8: 47,093,032 V386L probably damaging Het
Eps15l1 T C 8: 72,341,394 D904G probably damaging Het
Esrrb A G 12: 86,518,830 Y356C probably damaging Het
Flt3 A T 5: 147,354,699 S619T possibly damaging Het
Fndc7 A T 3: 108,858,902 C716S probably damaging Het
Gm10125 T C 18: 5,525,375 noncoding transcript Het
Gm26996 T A 6: 130,579,485 noncoding transcript Het
Grik2 A T 10: 49,422,615 F50I possibly damaging Het
Guf1 T C 5: 69,566,443 V367A possibly damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ifnar2 T C 16: 91,391,796 V55A probably benign Het
Impg1 T A 9: 80,440,854 I33F probably benign Het
Ltbp4 A C 7: 27,325,183 V674G probably damaging Het
Mroh2b T A 15: 4,918,290 L529H probably damaging Het
Negr1 T C 3: 157,208,386 probably benign Het
Neurog3 A G 10: 62,133,820 T25A probably damaging Het
Olfr1241 T A 2: 89,482,756 K126N probably damaging Het
Olfr1420 T C 19: 11,896,762 V247A probably benign Het
Olfr181 T C 16: 58,926,092 T160A probably benign Het
Olfr555 A C 7: 102,659,478 Y219S probably damaging Het
Pax8 T A 2: 24,443,189 probably benign Het
Pcsk6 A C 7: 65,931,732 I254L possibly damaging Het
Pde3a A G 6: 141,459,216 K389R probably benign Het
Rab3gap1 C A 1: 127,925,259 probably benign Het
Rbck1 G A 2: 152,318,733 Q428* probably null Het
Rptor A G 11: 119,798,840 D321G probably null Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Sdccag3 C A 2: 26,388,897 probably benign Het
Skp1a T C 11: 52,243,619 I59T possibly damaging Het
Slc23a3 T G 1: 75,128,556 N456T probably damaging Het
Slc4a7 G A 14: 14,778,850 G920S probably damaging Het
Smarcd3 T C 5: 24,592,804 I467V probably benign Het
Spata31d1c C T 13: 65,036,060 A472V probably damaging Het
Srsf6 T C 2: 162,931,723 I18T probably damaging Het
Stom C T 2: 35,323,746 G80D probably damaging Het
Svep1 A T 4: 58,084,028 Y1915N possibly damaging Het
Tmf1 C T 6: 97,173,400 V449I probably benign Het
Triobp C T 15: 78,967,095 A483V probably benign Het
Vdac1 G A 11: 52,374,972 probably null Het
Vmn2r75 T G 7: 86,166,286 E123D probably benign Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Zdbf2 T G 1: 63,306,591 N1376K possibly damaging Het
Other mutations in Ccdc189
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Ccdc189 APN 7 127585038 missense probably damaging 0.99
IGL02805:Ccdc189 APN 7 127586394 missense possibly damaging 0.93
R0197:Ccdc189 UTSW 7 127584862 missense probably damaging 0.98
R0883:Ccdc189 UTSW 7 127584862 missense probably damaging 0.98
R1695:Ccdc189 UTSW 7 127587573 splice site probably null
R1699:Ccdc189 UTSW 7 127586856 splice site probably null
R4230:Ccdc189 UTSW 7 127586830 missense probably benign 0.18
R4427:Ccdc189 UTSW 7 127588116 unclassified probably benign
R7741:Ccdc189 UTSW 7 127587987 missense probably benign 0.00
R7920:Ccdc189 UTSW 7 127587953 missense probably benign 0.00
R8228:Ccdc189 UTSW 7 127585007 missense probably benign 0.41
X0021:Ccdc189 UTSW 7 127585521 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGCTAGTCTGCCAAAAGC -3'
(R):5'- AGGGAAGGACCTTGTCTGTC -3'

Sequencing Primer
(F):5'- CAGCTGTCTAGAAGCAGGGC -3'
(R):5'- CTGTCTTTGAGTGCCGAGAAAAG -3'
Posted On2015-09-24