Incidental Mutation 'R4592:Enpp6'
ID342905
Institutional Source Beutler Lab
Gene Symbol Enpp6
Ensembl Gene ENSMUSG00000038173
Gene Nameectonucleotide pyrophosphatase/phosphodiesterase 6
Synonyms4833421B01Rik, D8Ertd514e, Npp6, B830047L21Rik
MMRRC Submission 041808-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.180) question?
Stock #R4592 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location46986887-47096762 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 47093032 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 386 (V386L)
Ref Sequence ENSEMBL: ENSMUSP00000044608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039840] [ENSMUST00000123066]
Predicted Effect probably damaging
Transcript: ENSMUST00000039840
AA Change: V386L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000044608
Gene: ENSMUSG00000038173
AA Change: V386L

DomainStartEndE-ValueType
Pfam:Phosphodiest 26 357 1.3e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210466
Meta Mutation Damage Score 0.4702 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: This gene encodes a member of the nucleotide pyrophosphatase/phosphodiesterase family of enzymes that play an important role in regulating extracellular nucleotide metabolism. The encoded preproprotein undergoes proteolytic processing to generate a glycosylphosphatidylinositol (GPI)-anchored membrane protein that hydrolyzes choline-containing lysophospholipids such as glycerophosphocholine. Mice lacking the encoded protein develop fatty liver and myelin sheath abnormalities. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik A G 11: 97,771,615 S144P probably damaging Het
4933430I17Rik T A 4: 62,538,927 V161E possibly damaging Het
Arhgap40 T C 2: 158,546,709 V521A possibly damaging Het
Atrn T C 2: 130,999,130 probably benign Het
Casp12 T C 9: 5,352,923 probably benign Het
Ccdc189 C T 7: 127,585,491 R172H probably benign Het
Cenpf G A 1: 189,679,033 T318M probably damaging Het
Clcn2 T C 16: 20,709,142 K525E probably damaging Het
Cntln A G 4: 84,971,182 T301A probably benign Het
Crat T C 2: 30,415,366 probably benign Het
Cul5 A G 9: 53,633,727 probably benign Het
Cxcl14 A T 13: 56,295,895 I34N probably damaging Het
Cyp2b19 A G 7: 26,771,394 I487V probably benign Het
Cyp4a10 T A 4: 115,529,493 F446I probably damaging Het
D430041D05Rik T A 2: 104,233,479 M659L possibly damaging Het
Dclk3 T C 9: 111,467,895 F169S probably damaging Het
Ddx52 T C 11: 83,957,480 I532T probably damaging Het
Dnm1 T C 2: 32,336,011 D352G probably damaging Het
Eif4g2 T C 7: 111,078,302 E174G probably damaging Het
Eps15l1 T C 8: 72,341,394 D904G probably damaging Het
Esrrb A G 12: 86,518,830 Y356C probably damaging Het
Flt3 A T 5: 147,354,699 S619T possibly damaging Het
Fndc7 A T 3: 108,858,902 C716S probably damaging Het
Gm10125 T C 18: 5,525,375 noncoding transcript Het
Gm26996 T A 6: 130,579,485 noncoding transcript Het
Grik2 A T 10: 49,422,615 F50I possibly damaging Het
Guf1 T C 5: 69,566,443 V367A possibly damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ifnar2 T C 16: 91,391,796 V55A probably benign Het
Impg1 T A 9: 80,440,854 I33F probably benign Het
Ltbp4 A C 7: 27,325,183 V674G probably damaging Het
Mroh2b T A 15: 4,918,290 L529H probably damaging Het
Negr1 T C 3: 157,208,386 probably benign Het
Neurog3 A G 10: 62,133,820 T25A probably damaging Het
Olfr1241 T A 2: 89,482,756 K126N probably damaging Het
Olfr1420 T C 19: 11,896,762 V247A probably benign Het
Olfr181 T C 16: 58,926,092 T160A probably benign Het
Olfr555 A C 7: 102,659,478 Y219S probably damaging Het
Pax8 T A 2: 24,443,189 probably benign Het
Pcsk6 A C 7: 65,931,732 I254L possibly damaging Het
Pde3a A G 6: 141,459,216 K389R probably benign Het
Rab3gap1 C A 1: 127,925,259 probably benign Het
Rbck1 G A 2: 152,318,733 Q428* probably null Het
Rptor A G 11: 119,798,840 D321G probably null Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Sdccag3 C A 2: 26,388,897 probably benign Het
Skp1a T C 11: 52,243,619 I59T possibly damaging Het
Slc23a3 T G 1: 75,128,556 N456T probably damaging Het
Slc4a7 G A 14: 14,778,850 G920S probably damaging Het
Smarcd3 T C 5: 24,592,804 I467V probably benign Het
Spata31d1c C T 13: 65,036,060 A472V probably damaging Het
Srsf6 T C 2: 162,931,723 I18T probably damaging Het
Stom C T 2: 35,323,746 G80D probably damaging Het
Svep1 A T 4: 58,084,028 Y1915N possibly damaging Het
Tmf1 C T 6: 97,173,400 V449I probably benign Het
Triobp C T 15: 78,967,095 A483V probably benign Het
Vdac1 G A 11: 52,374,972 probably null Het
Vmn2r75 T G 7: 86,166,286 E123D probably benign Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Zdbf2 T G 1: 63,306,591 N1376K possibly damaging Het
Other mutations in Enpp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02215:Enpp6 APN 8 47065932 missense probably damaging 1.00
IGL02882:Enpp6 APN 8 47030532 missense probably damaging 1.00
R0025:Enpp6 UTSW 8 47066000 missense probably damaging 0.99
R0025:Enpp6 UTSW 8 47066000 missense probably damaging 0.99
R0331:Enpp6 UTSW 8 47082449 missense probably damaging 1.00
R0525:Enpp6 UTSW 8 47082443 missense possibly damaging 0.68
R1168:Enpp6 UTSW 8 47030454 missense probably damaging 0.96
R1295:Enpp6 UTSW 8 47065500 missense probably benign 0.00
R1533:Enpp6 UTSW 8 47065434 missense probably benign 0.02
R1923:Enpp6 UTSW 8 47082506 missense probably damaging 0.98
R2031:Enpp6 UTSW 8 47053614 missense probably damaging 0.99
R2090:Enpp6 UTSW 8 47065370 critical splice acceptor site probably null
R2656:Enpp6 UTSW 8 47082418 nonsense probably null
R3620:Enpp6 UTSW 8 47065505 missense probably benign 0.03
R3621:Enpp6 UTSW 8 47065505 missense probably benign 0.03
R3862:Enpp6 UTSW 8 47065992 missense probably benign 0.33
R4284:Enpp6 UTSW 8 47069015 missense probably damaging 1.00
R4899:Enpp6 UTSW 8 46987083 missense probably damaging 1.00
R4963:Enpp6 UTSW 8 47065461 missense probably benign 0.30
R5201:Enpp6 UTSW 8 47065451 missense probably damaging 0.99
R5322:Enpp6 UTSW 8 47068915 missense probably benign 0.06
R5933:Enpp6 UTSW 8 47066004 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- ATAGCCTTCCACATAGGCTACCTC -3'
(R):5'- ACAGTGCTTTGGAATGAGCC -3'

Sequencing Primer
(F):5'- GGCTACCTCATTTACAGTAACTTAGC -3'
(R):5'- CAGTGCTTTGGAATGAGCCATAGG -3'
Posted On2015-09-24