Incidental Mutation 'R4592:Skp1a'
ID 342913
Institutional Source Beutler Lab
Gene Symbol Skp1a
Ensembl Gene ENSMUSG00000036309
Gene Name S-phase kinase-associated protein 1A
Synonyms 2610043E24Rik, Tceb1l, p19Skp1, 2610206H23Rik
MMRRC Submission 041808-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.601) question?
Stock # R4592 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 52231995-52246858 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 52243619 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 59 (I59T)
Ref Sequence ENSEMBL: ENSMUSP00000104700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037324] [ENSMUST00000109072] [ENSMUST00000116595] [ENSMUST00000147684] [ENSMUST00000166537]
AlphaFold Q9WTX5
Predicted Effect possibly damaging
Transcript: ENSMUST00000037324
AA Change: I59T

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038744
Gene: ENSMUSG00000036309
AA Change: I59T

DomainStartEndE-ValueType
Skp1 1 112 1.13e-64 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109072
AA Change: I59T

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000104700
Gene: ENSMUSG00000036309
AA Change: I59T

DomainStartEndE-ValueType
Skp1 1 112 1.13e-64 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116595
SMART Domains Protein: ENSMUSP00000112294
Gene: ENSMUSG00000036309

DomainStartEndE-ValueType
Pfam:Skp1_POZ 1 28 6.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147684
SMART Domains Protein: ENSMUSP00000129711
Gene: ENSMUSG00000036309

DomainStartEndE-ValueType
Pfam:Skp1_POZ 2 47 1.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166537
SMART Domains Protein: ENSMUSP00000131833
Gene: ENSMUSG00000036309

DomainStartEndE-ValueType
Skp1 1 64 1.04e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181262
Meta Mutation Damage Score 0.7130 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of SCF complexes, which are composed of this protein, cullin 1, a ring-box protein, and one member of the F-box family of proteins. This protein binds directly to the F-box motif found in F-box proteins. SCF complexes are involved in the regulated ubiquitination of specific protein substrates, which targets them for degradation by the proteosome. Specific F-box proteins recognize different target protein(s), and many specific SCF substrates have been identified including regulators of cell cycle progression and development. Studies have also characterized the protein as an RNA polymerase II elongation factor. Alternative splicing of this gene results in two transcript variants. A related pseudogene has been identified on chromosome 7. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik A G 11: 97,771,615 S144P probably damaging Het
4933430I17Rik T A 4: 62,538,927 V161E possibly damaging Het
Arhgap40 T C 2: 158,546,709 V521A possibly damaging Het
Atrn T C 2: 130,999,130 probably benign Het
Casp12 T C 9: 5,352,923 probably benign Het
Ccdc189 C T 7: 127,585,491 R172H probably benign Het
Cenpf G A 1: 189,679,033 T318M probably damaging Het
Clcn2 T C 16: 20,709,142 K525E probably damaging Het
Cntln A G 4: 84,971,182 T301A probably benign Het
Crat T C 2: 30,415,366 probably benign Het
Cul5 A G 9: 53,633,727 probably benign Het
Cxcl14 A T 13: 56,295,895 I34N probably damaging Het
Cyp2b19 A G 7: 26,771,394 I487V probably benign Het
Cyp4a10 T A 4: 115,529,493 F446I probably damaging Het
D430041D05Rik T A 2: 104,233,479 M659L possibly damaging Het
Dclk3 T C 9: 111,467,895 F169S probably damaging Het
Ddx52 T C 11: 83,957,480 I532T probably damaging Het
Dnm1 T C 2: 32,336,011 D352G probably damaging Het
Eif4g2 T C 7: 111,078,302 E174G probably damaging Het
Enpp6 G T 8: 47,093,032 V386L probably damaging Het
Eps15l1 T C 8: 72,341,394 D904G probably damaging Het
Esrrb A G 12: 86,518,830 Y356C probably damaging Het
Flt3 A T 5: 147,354,699 S619T possibly damaging Het
Fndc7 A T 3: 108,858,902 C716S probably damaging Het
Gm10125 T C 18: 5,525,375 noncoding transcript Het
Gm26996 T A 6: 130,579,485 noncoding transcript Het
Grik2 A T 10: 49,422,615 F50I possibly damaging Het
Guf1 T C 5: 69,566,443 V367A possibly damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ifnar2 T C 16: 91,391,796 V55A probably benign Het
Impg1 T A 9: 80,440,854 I33F probably benign Het
Ltbp4 A C 7: 27,325,183 V674G probably damaging Het
Mroh2b T A 15: 4,918,290 L529H probably damaging Het
Negr1 T C 3: 157,208,386 probably benign Het
Neurog3 A G 10: 62,133,820 T25A probably damaging Het
Olfr1241 T A 2: 89,482,756 K126N probably damaging Het
Olfr1420 T C 19: 11,896,762 V247A probably benign Het
Olfr181 T C 16: 58,926,092 T160A probably benign Het
Olfr555 A C 7: 102,659,478 Y219S probably damaging Het
Pax8 T A 2: 24,443,189 probably benign Het
Pcsk6 A C 7: 65,931,732 I254L possibly damaging Het
Pde3a A G 6: 141,459,216 K389R probably benign Het
Rab3gap1 C A 1: 127,925,259 probably benign Het
Rbck1 G A 2: 152,318,733 Q428* probably null Het
Rptor A G 11: 119,798,840 D321G probably null Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Sdccag3 C A 2: 26,388,897 probably benign Het
Slc23a3 T G 1: 75,128,556 N456T probably damaging Het
Slc4a7 G A 14: 14,778,850 G920S probably damaging Het
Smarcd3 T C 5: 24,592,804 I467V probably benign Het
Spata31d1c C T 13: 65,036,060 A472V probably damaging Het
Srsf6 T C 2: 162,931,723 I18T probably damaging Het
Stom C T 2: 35,323,746 G80D probably damaging Het
Svep1 A T 4: 58,084,028 Y1915N possibly damaging Het
Tmf1 C T 6: 97,173,400 V449I probably benign Het
Triobp C T 15: 78,967,095 A483V probably benign Het
Vdac1 G A 11: 52,374,972 probably null Het
Vmn2r75 T G 7: 86,166,286 E123D probably benign Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Zdbf2 T G 1: 63,306,591 N1376K possibly damaging Het
Other mutations in Skp1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0689:Skp1a UTSW 11 52243765 intron probably benign
R1004:Skp1a UTSW 11 52237380 intron probably benign
R1710:Skp1a UTSW 11 52242615 missense probably benign 0.00
R2250:Skp1a UTSW 11 52243619 missense possibly damaging 0.95
R4468:Skp1a UTSW 11 52245078 missense probably benign 0.04
R4469:Skp1a UTSW 11 52245078 missense probably benign 0.04
R4976:Skp1a UTSW 11 52243631 missense probably benign 0.01
R5576:Skp1a UTSW 11 52242588 missense possibly damaging 0.76
R8746:Skp1a UTSW 11 52246016 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTGTTAACCAGCAAGCAC -3'
(R):5'- TAGGTAAAGGCTCTGCAACAGAAC -3'

Sequencing Primer
(F):5'- TGACTGAGCTATCTTACCAGCGAG -3'
(R):5'- GGCTCTGCAACAGAACTACTTTATAC -3'
Posted On 2015-09-24