Mutagenetix > Incidental Mutations

Incidental Mutation 'R4592:Rptor'

342917

Institutional Source

Beutler Lab

Gene Symbol

Rptor

Ensembl Gene

ENSMUSG00000025583

Gene Name

regulatory associated protein of MTOR, complex 1

Synonyms

raptor, Rap, 4932417H02Rik

MMRRC Submission

041808-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4592 (G1)

Quality Score

163

Status

Validated

Chromosome

Chromosomal Location

119602905-119899576 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 119798840 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 321 (D321G)

Ref Sequence

ENSEMBL: ENSMUSP00000026671 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026671] [ENSMUST00000139728] [ENSMUST00000147781]

Predicted Effect

probably null
Transcript: ENSMUST00000026671
AA Change: D321G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000026671
Gene: ENSMUSG00000025583
AA Change: D321G

Domain	Start	End	E-Value	Type
Raptor_N	54	207	2.3e-98	SMART
Pfam:HEAT_2	559	668	7.9e-11	PFAM
Pfam:HEAT	602	630	1.9e-6	PFAM
low complexity region	755	772	N/A	INTRINSIC
low complexity region	877	887	N/A	INTRINSIC
low complexity region	939	945	N/A	INTRINSIC
WD40	1012	1050	2.56e1	SMART
WD40	1052	1097	4.28e0	SMART
WD40	1105	1151	1.83e2	SMART
WD40	1154	1194	1.82e-2	SMART
WD40	1200	1240	5.35e-1	SMART
WD40	1246	1281	7.13e0	SMART
WD40	1283	1329	2.67e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125583

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127899

Predicted Effect

probably damaging
Transcript: ENSMUST00000139728
AA Change: D23G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147772

Predicted Effect

probably damaging
Transcript: ENSMUST00000147781
AA Change: D321G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124366
Gene: ENSMUSG00000025583
AA Change: D321G

Domain	Start	End	E-Value	Type
Raptor_N	54	207	2.3e-98	SMART

Meta Mutation Damage Score

0.9601

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (64/65)

MGI Phenotype

FUNCTION: This gene encodes a subunit of mammalian target of rapamycin complex 1 (mTORC1), a component of the mTOR signaling pathway, which regulates cell growth in response to nutrient and energy levels. The encoded protein may regulate the assembly, localization, and substrate binding of the mTORC1 complex. Homozygous knockout mice for this gene exhibit embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in lethality prior to somitogenesis. Mice homozygous for a conditional allele activated in dendritic cells exhibit increased susceptibility to induced colitis and expansion of certain populations of dendritic cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001P01Rik	A	G	11: 97,771,615	S144P	probably damaging	Het
4933430I17Rik	T	A	4: 62,538,927	V161E	possibly damaging	Het
Arhgap40	T	C	2: 158,546,709	V521A	possibly damaging	Het
Atrn	T	C	2: 130,999,130		probably benign	Het
Casp12	T	C	9: 5,352,923		probably benign	Het
Ccdc189	C	T	7: 127,585,491	R172H	probably benign	Het
Cenpf	G	A	1: 189,679,033	T318M	probably damaging	Het
Clcn2	T	C	16: 20,709,142	K525E	probably damaging	Het
Cntln	A	G	4: 84,971,182	T301A	probably benign	Het
Crat	T	C	2: 30,415,366		probably benign	Het
Cul5	A	G	9: 53,633,727		probably benign	Het
Cxcl14	A	T	13: 56,295,895	I34N	probably damaging	Het
Cyp2b19	A	G	7: 26,771,394	I487V	probably benign	Het
Cyp4a10	T	A	4: 115,529,493	F446I	probably damaging	Het
D430041D05Rik	T	A	2: 104,233,479	M659L	possibly damaging	Het
Dclk3	T	C	9: 111,467,895	F169S	probably damaging	Het
Ddx52	T	C	11: 83,957,480	I532T	probably damaging	Het
Dnm1	T	C	2: 32,336,011	D352G	probably damaging	Het
Eif4g2	T	C	7: 111,078,302	E174G	probably damaging	Het
Enpp6	G	T	8: 47,093,032	V386L	probably damaging	Het
Eps15l1	T	C	8: 72,341,394	D904G	probably damaging	Het
Esrrb	A	G	12: 86,518,830	Y356C	probably damaging	Het
Flt3	A	T	5: 147,354,699	S619T	possibly damaging	Het
Fndc7	A	T	3: 108,858,902	C716S	probably damaging	Het
Gm10125	T	C	18: 5,525,375		noncoding transcript	Het
Gm26996	T	A	6: 130,579,485		noncoding transcript	Het
Grik2	A	T	10: 49,422,615	F50I	possibly damaging	Het
Guf1	T	C	5: 69,566,443	V367A	possibly damaging	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Ifnar2	T	C	16: 91,391,796	V55A	probably benign	Het
Impg1	T	A	9: 80,440,854	I33F	probably benign	Het
Ltbp4	A	C	7: 27,325,183	V674G	probably damaging	Het
Mroh2b	T	A	15: 4,918,290	L529H	probably damaging	Het
Negr1	T	C	3: 157,208,386		probably benign	Het
Neurog3	A	G	10: 62,133,820	T25A	probably damaging	Het
Olfr1241	T	A	2: 89,482,756	K126N	probably damaging	Het
Olfr1420	T	C	19: 11,896,762	V247A	probably benign	Het
Olfr181	T	C	16: 58,926,092	T160A	probably benign	Het
Olfr555	A	C	7: 102,659,478	Y219S	probably damaging	Het
Pax8	T	A	2: 24,443,189		probably benign	Het
Pcsk6	A	C	7: 65,931,732	I254L	possibly damaging	Het
Pde3a	A	G	6: 141,459,216	K389R	probably benign	Het
Rab3gap1	C	A	1: 127,925,259		probably benign	Het
Rbck1	G	A	2: 152,318,733	Q428*	probably null	Het
Sall2	C	A	14: 52,313,803	R643L	probably damaging	Het
Sdccag3	C	A	2: 26,388,897		probably benign	Het
Skp1a	T	C	11: 52,243,619	I59T	possibly damaging	Het
Slc23a3	T	G	1: 75,128,556	N456T	probably damaging	Het
Slc4a7	G	A	14: 14,778,850	G920S	probably damaging	Het
Smarcd3	T	C	5: 24,592,804	I467V	probably benign	Het
Spata31d1c	C	T	13: 65,036,060	A472V	probably damaging	Het
Srsf6	T	C	2: 162,931,723	I18T	probably damaging	Het
Stom	C	T	2: 35,323,746	G80D	probably damaging	Het
Svep1	A	T	4: 58,084,028	Y1915N	possibly damaging	Het
Tmf1	C	T	6: 97,173,400	V449I	probably benign	Het
Triobp	C	T	15: 78,967,095	A483V	probably benign	Het
Vdac1	G	A	11: 52,374,972		probably null	Het
Vmn2r75	T	G	7: 86,166,286	E123D	probably benign	Het
Vmn2r79	T	A	7: 87,004,111	V528D	possibly damaging	Het
Zdbf2	T	G	1: 63,306,591	N1376K	possibly damaging	Het

Other mutations in Rptor

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00537:Rptor	APN	11	119799445	missense	possibly damaging	0.92
IGL01319:Rptor	APN	11	119891170	missense	probably benign	0.01
IGL01375:Rptor	APN	11	119896436	missense	possibly damaging	0.68
IGL01899:Rptor	APN	11	119857453	missense	probably benign	0.04
IGL01927:Rptor	APN	11	119657674	missense	probably damaging	1.00
IGL02312:Rptor	APN	11	119846915	missense	possibly damaging	0.84
IGL02620:Rptor	APN	11	119780587	missense	probably benign	0.12
IGL02651:Rptor	APN	11	119892612	missense	possibly damaging	0.69
IGL03182:Rptor	APN	11	119725145	missense	probably damaging	1.00
Velocipede	UTSW	11	119895977	missense	possibly damaging	0.92
R0103:Rptor	UTSW	11	119884967	missense	probably benign	0.01
R0179:Rptor	UTSW	11	119872367	missense	probably benign	0.14
R0217:Rptor	UTSW	11	119894912	splice site	probably benign
R0219:Rptor	UTSW	11	119821777	intron	probably benign
R0324:Rptor	UTSW	11	119892641	missense	probably damaging	1.00
R0432:Rptor	UTSW	11	119780553	nonsense	probably null
R0718:Rptor	UTSW	11	119872376	missense	probably benign	0.15
R0730:Rptor	UTSW	11	119884954	missense	probably benign	0.06
R1019:Rptor	UTSW	11	119843743	missense	probably damaging	1.00
R1073:Rptor	UTSW	11	119743891	missense	possibly damaging	0.93
R1424:Rptor	UTSW	11	119780593	nonsense	probably null
R1579:Rptor	UTSW	11	119896001	missense	probably benign	0.00
R1766:Rptor	UTSW	11	119725061	missense	probably damaging	0.99
R1844:Rptor	UTSW	11	119756320	missense	probably damaging	1.00
R2180:Rptor	UTSW	11	119725144	missense	probably damaging	1.00
R2274:Rptor	UTSW	11	119756322	nonsense	probably null
R2275:Rptor	UTSW	11	119756322	nonsense	probably null
R2408:Rptor	UTSW	11	119857451	missense	probably damaging	0.99
R2981:Rptor	UTSW	11	119865594	missense	probably damaging	1.00
R2996:Rptor	UTSW	11	119856298	missense	probably damaging	1.00
R3001:Rptor	UTSW	11	119872371	missense	possibly damaging	0.94
R3002:Rptor	UTSW	11	119872371	missense	possibly damaging	0.94
R3003:Rptor	UTSW	11	119872371	missense	possibly damaging	0.94
R4358:Rptor	UTSW	11	119671345	missense	probably damaging	0.98
R4647:Rptor	UTSW	11	119891163	missense	probably benign	0.33
R4666:Rptor	UTSW	11	119743882	missense	probably damaging	1.00
R4958:Rptor	UTSW	11	119857391	missense	probably benign	0.29
R4974:Rptor	UTSW	11	119821640	intron	probably benign
R5073:Rptor	UTSW	11	119896479	missense	possibly damaging	0.71
R5199:Rptor	UTSW	11	119603816	missense	probably benign
R5216:Rptor	UTSW	11	119843713	missense	probably damaging	0.98
R5219:Rptor	UTSW	11	119843713	missense	probably damaging	0.98
R5277:Rptor	UTSW	11	119822956	missense	probably damaging	1.00
R5365:Rptor	UTSW	11	119843713	missense	probably damaging	0.98
R5366:Rptor	UTSW	11	119843713	missense	probably damaging	0.98
R5447:Rptor	UTSW	11	119843713	missense	probably damaging	0.98
R5630:Rptor	UTSW	11	119756249	missense	probably benign	0.01
R6220:Rptor	UTSW	11	119897442	missense	possibly damaging	0.83
R6567:Rptor	UTSW	11	119896012	missense	probably benign	0.00
R6741:Rptor	UTSW	11	119895977	missense	possibly damaging	0.92
R6915:Rptor	UTSW	11	119756345	missense	probably damaging	0.99
R7032:Rptor	UTSW	11	119846936	missense	probably benign	0.00
R7051:Rptor	UTSW	11	119874186	utr 3 prime	probably benign
R7396:Rptor	UTSW	11	119872355	missense	probably benign	0.10
R7429:Rptor	UTSW	11	119846828	missense	probably damaging	1.00
R7430:Rptor	UTSW	11	119846828	missense	probably damaging	1.00
R7447:Rptor	UTSW	11	119884979	missense	probably benign	0.00
R7595:Rptor	UTSW	11	119743953	missense	possibly damaging	0.82
R7776:Rptor	UTSW	11	119892627	missense	probably benign	0.01
R7854:Rptor	UTSW	11	119857953	missense	probably benign	0.02
R8288:Rptor	UTSW	11	119857937	missense	probably benign	0.02
R8305:Rptor	UTSW	11	119811986	missense	probably damaging	1.00
R8328:Rptor	UTSW	11	119892647	missense	probably benign	0.00
R8351:Rptor	UTSW	11	119892639	missense	probably benign	0.22
R8772:Rptor	UTSW	11	119725032	missense	probably damaging	1.00
X0050:Rptor	UTSW	11	119846405	missense	probably benign	0.14
X0066:Rptor	UTSW	11	119857866	missense	probably benign	0.31
Z0001:Rptor	UTSW	11	119603972	critical splice donor site	probably null
Z0001:Rptor	UTSW	11	119756236	splice site	probably null
Z0001:Rptor	UTSW	11	119756415	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119799319	critical splice acceptor site	probably benign
Z0001:Rptor	UTSW	11	119846752	critical splice acceptor site	probably null
Z0001:Rptor	UTSW	11	119851468	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119857453	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119871492	critical splice acceptor site	probably benign
Z0001:Rptor	UTSW	11	119874151	critical splice acceptor site	probably benign
Z0001:Rptor	UTSW	11	119896549	critical splice donor site	probably benign

Predicted Primers

PCR Primer
(F):5'- CTGCTGTCTTTGAGCCTGAG -3'
(R):5'- TTATTCAGGAAGCTGAGCCCC -3'

Sequencing Primer
(F):5'- AGGCTCTCCCTCTCTGTTC -3'
(R):5'- GCATTACGGAGCTGAGAGC -3'

Posted On

2015-09-24