Incidental Mutation 'R4592:Esrrb'
ID342918
Institutional Source Beutler Lab
Gene Symbol Esrrb
Ensembl Gene ENSMUSG00000021255
Gene Nameestrogen related receptor, beta
SynonymsERR2, Err2, Estrrb, ERRb
MMRRC Submission 041808-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4592 (G1)
Quality Score136
Status Validated
Chromosome12
Chromosomal Location86361117-86521628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86518830 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 356 (Y356C)
Ref Sequence ENSEMBL: ENSMUSP00000131335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021680] [ENSMUST00000110203] [ENSMUST00000110204] [ENSMUST00000116402] [ENSMUST00000167891]
Predicted Effect probably damaging
Transcript: ENSMUST00000021680
AA Change: Y356C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021680
Gene: ENSMUSG00000021255
AA Change: Y356C

DomainStartEndE-ValueType
low complexity region 31 46 N/A INTRINSIC
ZnF_C4 100 171 7.03e-40 SMART
Blast:HOLI 178 208 3e-9 BLAST
HOLI 245 403 6.36e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110203
SMART Domains Protein: ENSMUSP00000105832
Gene: ENSMUSG00000021255

DomainStartEndE-ValueType
low complexity region 52 67 N/A INTRINSIC
ZnF_C4 121 192 7.03e-40 SMART
HOLI 266 377 6.61e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110204
AA Change: Y377C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105833
Gene: ENSMUSG00000021255
AA Change: Y377C

DomainStartEndE-ValueType
low complexity region 52 67 N/A INTRINSIC
ZnF_C4 121 192 7.03e-40 SMART
Blast:HOLI 199 229 3e-9 BLAST
HOLI 266 424 6.36e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000116402
AA Change: Y361C

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112103
Gene: ENSMUSG00000021255
AA Change: Y361C

DomainStartEndE-ValueType
low complexity region 36 51 N/A INTRINSIC
ZnF_C4 105 176 7.03e-40 SMART
Blast:HOLI 183 213 3e-9 BLAST
HOLI 250 408 6.36e-38 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167891
AA Change: Y356C

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131335
Gene: ENSMUSG00000021255
AA Change: Y356C

DomainStartEndE-ValueType
low complexity region 31 46 N/A INTRINSIC
ZnF_C4 100 171 7.03e-40 SMART
Blast:HOLI 178 208 3e-9 BLAST
HOLI 245 403 6.36e-38 SMART
Meta Mutation Damage Score 0.1649 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with similarity to the estrogen receptor. Its function is unknown; however, a similar protein in mouse plays an essential role in placental development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos around E9.5 or E10.5 as a result of failure of the chorion to develop and subsequent placental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik A G 11: 97,771,615 S144P probably damaging Het
4933430I17Rik T A 4: 62,538,927 V161E possibly damaging Het
Arhgap40 T C 2: 158,546,709 V521A possibly damaging Het
Atrn T C 2: 130,999,130 probably benign Het
Casp12 T C 9: 5,352,923 probably benign Het
Ccdc189 C T 7: 127,585,491 R172H probably benign Het
Cenpf G A 1: 189,679,033 T318M probably damaging Het
Clcn2 T C 16: 20,709,142 K525E probably damaging Het
Cntln A G 4: 84,971,182 T301A probably benign Het
Crat T C 2: 30,415,366 probably benign Het
Cul5 A G 9: 53,633,727 probably benign Het
Cxcl14 A T 13: 56,295,895 I34N probably damaging Het
Cyp2b19 A G 7: 26,771,394 I487V probably benign Het
Cyp4a10 T A 4: 115,529,493 F446I probably damaging Het
D430041D05Rik T A 2: 104,233,479 M659L possibly damaging Het
Dclk3 T C 9: 111,467,895 F169S probably damaging Het
Ddx52 T C 11: 83,957,480 I532T probably damaging Het
Dnm1 T C 2: 32,336,011 D352G probably damaging Het
Eif4g2 T C 7: 111,078,302 E174G probably damaging Het
Enpp6 G T 8: 47,093,032 V386L probably damaging Het
Eps15l1 T C 8: 72,341,394 D904G probably damaging Het
Flt3 A T 5: 147,354,699 S619T possibly damaging Het
Fndc7 A T 3: 108,858,902 C716S probably damaging Het
Gm10125 T C 18: 5,525,375 noncoding transcript Het
Gm26996 T A 6: 130,579,485 noncoding transcript Het
Grik2 A T 10: 49,422,615 F50I possibly damaging Het
Guf1 T C 5: 69,566,443 V367A possibly damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ifnar2 T C 16: 91,391,796 V55A probably benign Het
Impg1 T A 9: 80,440,854 I33F probably benign Het
Ltbp4 A C 7: 27,325,183 V674G probably damaging Het
Mroh2b T A 15: 4,918,290 L529H probably damaging Het
Negr1 T C 3: 157,208,386 probably benign Het
Neurog3 A G 10: 62,133,820 T25A probably damaging Het
Olfr1241 T A 2: 89,482,756 K126N probably damaging Het
Olfr1420 T C 19: 11,896,762 V247A probably benign Het
Olfr181 T C 16: 58,926,092 T160A probably benign Het
Olfr555 A C 7: 102,659,478 Y219S probably damaging Het
Pax8 T A 2: 24,443,189 probably benign Het
Pcsk6 A C 7: 65,931,732 I254L possibly damaging Het
Pde3a A G 6: 141,459,216 K389R probably benign Het
Rab3gap1 C A 1: 127,925,259 probably benign Het
Rbck1 G A 2: 152,318,733 Q428* probably null Het
Rptor A G 11: 119,798,840 D321G probably null Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Sdccag3 C A 2: 26,388,897 probably benign Het
Skp1a T C 11: 52,243,619 I59T possibly damaging Het
Slc23a3 T G 1: 75,128,556 N456T probably damaging Het
Slc4a7 G A 14: 14,778,850 G920S probably damaging Het
Smarcd3 T C 5: 24,592,804 I467V probably benign Het
Spata31d1c C T 13: 65,036,060 A472V probably damaging Het
Srsf6 T C 2: 162,931,723 I18T probably damaging Het
Stom C T 2: 35,323,746 G80D probably damaging Het
Svep1 A T 4: 58,084,028 Y1915N possibly damaging Het
Tmf1 C T 6: 97,173,400 V449I probably benign Het
Triobp C T 15: 78,967,095 A483V probably benign Het
Vdac1 G A 11: 52,374,972 probably null Het
Vmn2r75 T G 7: 86,166,286 E123D probably benign Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Zdbf2 T G 1: 63,306,591 N1376K possibly damaging Het
Other mutations in Esrrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02621:Esrrb APN 12 86421961 missense probably benign
R0083:Esrrb UTSW 12 86514452 missense probably damaging 1.00
R0194:Esrrb UTSW 12 86470481 missense probably damaging 1.00
R0666:Esrrb UTSW 12 86505902 missense probably benign 0.01
R0834:Esrrb UTSW 12 86470297 missense probably benign 0.14
R0946:Esrrb UTSW 12 86505824 missense probably damaging 1.00
R1108:Esrrb UTSW 12 86505830 missense probably damaging 1.00
R1619:Esrrb UTSW 12 86514500 missense possibly damaging 0.78
R1674:Esrrb UTSW 12 86514451 missense probably damaging 1.00
R2139:Esrrb UTSW 12 86421966 critical splice donor site probably null
R5377:Esrrb UTSW 12 86519009 nonsense probably null
R5807:Esrrb UTSW 12 86514401 missense possibly damaging 0.93
R5871:Esrrb UTSW 12 86505887 missense probably benign 0.29
R6145:Esrrb UTSW 12 86505899 missense probably benign
R6467:Esrrb UTSW 12 86514340 missense probably damaging 1.00
R7098:Esrrb UTSW 12 86470415 missense probably benign 0.01
R7289:Esrrb UTSW 12 86470557 critical splice donor site probably null
R8283:Esrrb UTSW 12 86421958 missense probably benign
R8444:Esrrb UTSW 12 86505821 missense probably benign 0.29
R8712:Esrrb UTSW 12 86518950 missense probably damaging 1.00
R8791:Esrrb UTSW 12 86470282 missense probably damaging 0.98
R8794:Esrrb UTSW 12 86470264 missense probably damaging 1.00
R8812:Esrrb UTSW 12 86488550 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CTCCTGGTGGTCTCTCTATGAG -3'
(R):5'- ACTGTAGAAGTGTTGCACGG -3'

Sequencing Primer
(F):5'- ATGAGATCTGAGCTCAGTTCTACC -3'
(R):5'- AGAAGTGTTGCACGGCTTTG -3'
Posted On2015-09-24