Incidental Mutation 'R4592:Cxcl14'
ID 342919
Institutional Source Beutler Lab
Gene Symbol Cxcl14
Ensembl Gene ENSMUSG00000021508
Gene Name chemokine (C-X-C motif) ligand 14
Synonyms Kec, BRAK, 1200006I23Rik, Scyb14, 1110031L23Rik, MIP-2g
MMRRC Submission 041808-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.824) question?
Stock # R4592 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 56288643-56296551 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 56295895 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 34 (I34N)
Ref Sequence ENSEMBL: ENSMUSP00000021970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021970] [ENSMUST00000224801]
AlphaFold Q9WUQ5
Predicted Effect probably damaging
Transcript: ENSMUST00000021970
AA Change: I34N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021970
Gene: ENSMUSG00000021508
AA Change: I34N

DomainStartEndE-ValueType
low complexity region 3 15 N/A INTRINSIC
Pfam:IL8 17 86 2.9e-15 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000224801
AA Change: I34N
Meta Mutation Damage Score 0.9148 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This antimicrobial gene belongs to the cytokine gene family which encode secreted proteins involved in immunoregulatory and inflammatory processes. The protein encoded by this gene is structurally related to the CXC (Cys-X-Cys) subfamily of cytokines. Members of this subfamily are characterized by two cysteines separated by a single amino acid. This cytokine displays chemotactic activity for monocytes but not for lymphocytes, dendritic cells, neutrophils or macrophages. It has been implicated that this cytokine is involved in the homeostasis of monocyte-derived macrophages rather than in inflammation. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mutant cause partial lethality before weaning, however surviving null are small but fertile and show insulin-sensitive phenotype in female under high fat diet feeding condition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001P01Rik A G 11: 97,771,615 S144P probably damaging Het
4933430I17Rik T A 4: 62,538,927 V161E possibly damaging Het
Arhgap40 T C 2: 158,546,709 V521A possibly damaging Het
Atrn T C 2: 130,999,130 probably benign Het
Casp12 T C 9: 5,352,923 probably benign Het
Ccdc189 C T 7: 127,585,491 R172H probably benign Het
Cenpf G A 1: 189,679,033 T318M probably damaging Het
Clcn2 T C 16: 20,709,142 K525E probably damaging Het
Cntln A G 4: 84,971,182 T301A probably benign Het
Crat T C 2: 30,415,366 probably benign Het
Cul5 A G 9: 53,633,727 probably benign Het
Cyp2b19 A G 7: 26,771,394 I487V probably benign Het
Cyp4a10 T A 4: 115,529,493 F446I probably damaging Het
D430041D05Rik T A 2: 104,233,479 M659L possibly damaging Het
Dclk3 T C 9: 111,467,895 F169S probably damaging Het
Ddx52 T C 11: 83,957,480 I532T probably damaging Het
Dnm1 T C 2: 32,336,011 D352G probably damaging Het
Eif4g2 T C 7: 111,078,302 E174G probably damaging Het
Enpp6 G T 8: 47,093,032 V386L probably damaging Het
Eps15l1 T C 8: 72,341,394 D904G probably damaging Het
Esrrb A G 12: 86,518,830 Y356C probably damaging Het
Flt3 A T 5: 147,354,699 S619T possibly damaging Het
Fndc7 A T 3: 108,858,902 C716S probably damaging Het
Gm10125 T C 18: 5,525,375 noncoding transcript Het
Gm26996 T A 6: 130,579,485 noncoding transcript Het
Grik2 A T 10: 49,422,615 F50I possibly damaging Het
Guf1 T C 5: 69,566,443 V367A possibly damaging Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ifnar2 T C 16: 91,391,796 V55A probably benign Het
Impg1 T A 9: 80,440,854 I33F probably benign Het
Ltbp4 A C 7: 27,325,183 V674G probably damaging Het
Mroh2b T A 15: 4,918,290 L529H probably damaging Het
Negr1 T C 3: 157,208,386 probably benign Het
Neurog3 A G 10: 62,133,820 T25A probably damaging Het
Olfr1241 T A 2: 89,482,756 K126N probably damaging Het
Olfr1420 T C 19: 11,896,762 V247A probably benign Het
Olfr181 T C 16: 58,926,092 T160A probably benign Het
Olfr555 A C 7: 102,659,478 Y219S probably damaging Het
Pax8 T A 2: 24,443,189 probably benign Het
Pcsk6 A C 7: 65,931,732 I254L possibly damaging Het
Pde3a A G 6: 141,459,216 K389R probably benign Het
Rab3gap1 C A 1: 127,925,259 probably benign Het
Rbck1 G A 2: 152,318,733 Q428* probably null Het
Rptor A G 11: 119,798,840 D321G probably null Het
Sall2 C A 14: 52,313,803 R643L probably damaging Het
Sdccag3 C A 2: 26,388,897 probably benign Het
Skp1a T C 11: 52,243,619 I59T possibly damaging Het
Slc23a3 T G 1: 75,128,556 N456T probably damaging Het
Slc4a7 G A 14: 14,778,850 G920S probably damaging Het
Smarcd3 T C 5: 24,592,804 I467V probably benign Het
Spata31d1c C T 13: 65,036,060 A472V probably damaging Het
Srsf6 T C 2: 162,931,723 I18T probably damaging Het
Stom C T 2: 35,323,746 G80D probably damaging Het
Svep1 A T 4: 58,084,028 Y1915N possibly damaging Het
Tmf1 C T 6: 97,173,400 V449I probably benign Het
Triobp C T 15: 78,967,095 A483V probably benign Het
Vdac1 G A 11: 52,374,972 probably null Het
Vmn2r75 T G 7: 86,166,286 E123D probably benign Het
Vmn2r79 T A 7: 87,004,111 V528D possibly damaging Het
Zdbf2 T G 1: 63,306,591 N1376K possibly damaging Het
Other mutations in Cxcl14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03409:Cxcl14 APN 13 56292507 missense probably damaging 1.00
R6092:Cxcl14 UTSW 13 56295833 missense possibly damaging 0.95
R7448:Cxcl14 UTSW 13 56292531 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCAGTCGGTCTTGTCAAAG -3'
(R):5'- TGCTTGAAACCGAGAACCAAG -3'

Sequencing Primer
(F):5'- TCGGTCTTGTCAAAGGCAGAG -3'
(R):5'- ACCGAGAACCAAGCCGGG -3'
Posted On 2015-09-24