Mutagenetix > Incidental Mutations

Incidental Mutation 'R4592:Triobp'

342924

Institutional Source

Beutler Lab

Gene Symbol

Triobp

Ensembl Gene

ENSMUSG00000033088

Gene Name

TRIO and F-actin binding protein

Synonyms

EST478828, Mus EST 478828, Tara

MMRRC Submission

041808-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4592 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

78947724-79005869 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 78967095 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 483 (A483V)

Ref Sequence

ENSEMBL: ENSMUSP00000155397 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000140228]

Predicted Effect

probably benign
Transcript: ENSMUST00000109689
AA Change: A483V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088
AA Change: A483V

Domain	Start	End	E-Value	Type
low complexity region	130	154	N/A	INTRINSIC
low complexity region	291	311	N/A	INTRINSIC
internal_repeat_1	312	394	7.43e-13	PROSPERO
internal_repeat_1	390	540	7.43e-13	PROSPERO
low complexity region	585	600	N/A	INTRINSIC
low complexity region	638	657	N/A	INTRINSIC
low complexity region	697	729	N/A	INTRINSIC
low complexity region	767	777	N/A	INTRINSIC
low complexity region	885	901	N/A	INTRINSIC
low complexity region	903	923	N/A	INTRINSIC
low complexity region	995	1017	N/A	INTRINSIC
low complexity region	1054	1068	N/A	INTRINSIC
low complexity region	1221	1235	N/A	INTRINSIC
PH	1395	1492	6.2e-19	SMART
coiled coil region	1665	1692	N/A	INTRINSIC
coiled coil region	1727	1765	N/A	INTRINSIC
coiled coil region	1789	1851	N/A	INTRINSIC
coiled coil region	1885	1964	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000109690
AA Change: A483V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088
AA Change: A483V

Domain	Start	End	E-Value	Type
low complexity region	130	154	N/A	INTRINSIC
low complexity region	291	311	N/A	INTRINSIC
internal_repeat_1	312	394	9.24e-13	PROSPERO
internal_repeat_1	390	540	9.24e-13	PROSPERO
low complexity region	585	600	N/A	INTRINSIC
low complexity region	638	657	N/A	INTRINSIC
low complexity region	697	729	N/A	INTRINSIC
low complexity region	767	777	N/A	INTRINSIC
low complexity region	885	901	N/A	INTRINSIC
low complexity region	903	923	N/A	INTRINSIC
low complexity region	995	1017	N/A	INTRINSIC
low complexity region	1054	1068	N/A	INTRINSIC
low complexity region	1221	1235	N/A	INTRINSIC
PH	1441	1538	6.2e-19	SMART
coiled coil region	1711	1738	N/A	INTRINSIC
coiled coil region	1773	1811	N/A	INTRINSIC
coiled coil region	1835	1897	N/A	INTRINSIC
coiled coil region	1931	2010	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140228
AA Change: A483V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

98% (64/65)

MGI Phenotype

FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700001P01Rik	A	G	11: 97,771,615	S144P	probably damaging	Het
4933430I17Rik	T	A	4: 62,538,927	V161E	possibly damaging	Het
Arhgap40	T	C	2: 158,546,709	V521A	possibly damaging	Het
Atrn	T	C	2: 130,999,130		probably benign	Het
Casp12	T	C	9: 5,352,923		probably benign	Het
Ccdc189	C	T	7: 127,585,491	R172H	probably benign	Het
Cenpf	G	A	1: 189,679,033	T318M	probably damaging	Het
Clcn2	T	C	16: 20,709,142	K525E	probably damaging	Het
Cntln	A	G	4: 84,971,182	T301A	probably benign	Het
Crat	T	C	2: 30,415,366		probably benign	Het
Cul5	A	G	9: 53,633,727		probably benign	Het
Cxcl14	A	T	13: 56,295,895	I34N	probably damaging	Het
Cyp2b19	A	G	7: 26,771,394	I487V	probably benign	Het
Cyp4a10	T	A	4: 115,529,493	F446I	probably damaging	Het
D430041D05Rik	T	A	2: 104,233,479	M659L	possibly damaging	Het
Dclk3	T	C	9: 111,467,895	F169S	probably damaging	Het
Ddx52	T	C	11: 83,957,480	I532T	probably damaging	Het
Dnm1	T	C	2: 32,336,011	D352G	probably damaging	Het
Eif4g2	T	C	7: 111,078,302	E174G	probably damaging	Het
Enpp6	G	T	8: 47,093,032	V386L	probably damaging	Het
Eps15l1	T	C	8: 72,341,394	D904G	probably damaging	Het
Esrrb	A	G	12: 86,518,830	Y356C	probably damaging	Het
Flt3	A	T	5: 147,354,699	S619T	possibly damaging	Het
Fndc7	A	T	3: 108,858,902	C716S	probably damaging	Het
Gm10125	T	C	18: 5,525,375		noncoding transcript	Het
Gm26996	T	A	6: 130,579,485		noncoding transcript	Het
Grik2	A	T	10: 49,422,615	F50I	possibly damaging	Het
Guf1	T	C	5: 69,566,443	V367A	possibly damaging	Het
Hspg2	C	T	4: 137,518,940	R1010C	probably damaging	Het
Ifnar2	T	C	16: 91,391,796	V55A	probably benign	Het
Impg1	T	A	9: 80,440,854	I33F	probably benign	Het
Ltbp4	A	C	7: 27,325,183	V674G	probably damaging	Het
Mroh2b	T	A	15: 4,918,290	L529H	probably damaging	Het
Negr1	T	C	3: 157,208,386		probably benign	Het
Neurog3	A	G	10: 62,133,820	T25A	probably damaging	Het
Olfr1241	T	A	2: 89,482,756	K126N	probably damaging	Het
Olfr1420	T	C	19: 11,896,762	V247A	probably benign	Het
Olfr181	T	C	16: 58,926,092	T160A	probably benign	Het
Olfr555	A	C	7: 102,659,478	Y219S	probably damaging	Het
Pax8	T	A	2: 24,443,189		probably benign	Het
Pcsk6	A	C	7: 65,931,732	I254L	possibly damaging	Het
Pde3a	A	G	6: 141,459,216	K389R	probably benign	Het
Rab3gap1	C	A	1: 127,925,259		probably benign	Het
Rbck1	G	A	2: 152,318,733	Q428*	probably null	Het
Rptor	A	G	11: 119,798,840	D321G	probably null	Het
Sall2	C	A	14: 52,313,803	R643L	probably damaging	Het
Sdccag3	C	A	2: 26,388,897		probably benign	Het
Skp1a	T	C	11: 52,243,619	I59T	possibly damaging	Het
Slc23a3	T	G	1: 75,128,556	N456T	probably damaging	Het
Slc4a7	G	A	14: 14,778,850	G920S	probably damaging	Het
Smarcd3	T	C	5: 24,592,804	I467V	probably benign	Het
Spata31d1c	C	T	13: 65,036,060	A472V	probably damaging	Het
Srsf6	T	C	2: 162,931,723	I18T	probably damaging	Het
Stom	C	T	2: 35,323,746	G80D	probably damaging	Het
Svep1	A	T	4: 58,084,028	Y1915N	possibly damaging	Het
Tmf1	C	T	6: 97,173,400	V449I	probably benign	Het
Vdac1	G	A	11: 52,374,972		probably null	Het
Vmn2r75	T	G	7: 86,166,286	E123D	probably benign	Het
Vmn2r79	T	A	7: 87,004,111	V528D	possibly damaging	Het
Zdbf2	T	G	1: 63,306,591	N1376K	possibly damaging	Het

Other mutations in Triobp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01634:Triobp	APN	15	78993368	missense	probably damaging	1.00
IGL01904:Triobp	APN	15	78967364	missense	possibly damaging	0.80
IGL01957:Triobp	APN	15	78972647	critical splice donor site	probably null
IGL02085:Triobp	APN	15	78974297	splice site	probably benign
IGL02260:Triobp	APN	15	78966362	missense	probably benign	0.00
IGL02498:Triobp	APN	15	78961043	missense	probably benign	0.01
IGL02551:Triobp	APN	15	78973489	missense	probably benign
IGL02740:Triobp	APN	15	78966689	missense	probably benign	0.21
IGL02810:Triobp	APN	15	79002203	missense	possibly damaging	0.95
IGL03063:Triobp	APN	15	78990884	missense	probably damaging	1.00
FR4304:Triobp	UTSW	15	78993387	unclassified	probably benign
FR4340:Triobp	UTSW	15	78993390	unclassified	probably benign
FR4342:Triobp	UTSW	15	78993392	unclassified	probably benign
FR4449:Triobp	UTSW	15	78993389	unclassified	probably benign
FR4548:Triobp	UTSW	15	78993387	unclassified	probably benign
FR4548:Triobp	UTSW	15	78993390	unclassified	probably benign
R0276:Triobp	UTSW	15	78973676	missense	probably benign	0.09
R0309:Triobp	UTSW	15	78976540	missense	probably damaging	1.00
R0433:Triobp	UTSW	15	78968201	missense	possibly damaging	0.69
R0464:Triobp	UTSW	15	78966986	missense	possibly damaging	0.71
R0525:Triobp	UTSW	15	78973898	missense	possibly damaging	0.93
R0665:Triobp	UTSW	15	78973898	missense	possibly damaging	0.93
R0689:Triobp	UTSW	15	78959988	nonsense	probably null
R1149:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1149:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1151:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1152:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1510:Triobp	UTSW	15	79003767	missense	probably damaging	1.00
R1519:Triobp	UTSW	15	78973738	missense	probably benign	0.00
R1642:Triobp	UTSW	15	79002148	missense	probably damaging	1.00
R1732:Triobp	UTSW	15	78967228	missense	possibly damaging	0.69
R1755:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1975:Triobp	UTSW	15	78966708	missense	probably benign
R2051:Triobp	UTSW	15	79004540	missense	probably damaging	1.00
R2073:Triobp	UTSW	15	78973895	missense	probably damaging	0.99
R2260:Triobp	UTSW	15	78991440	critical splice donor site	probably null
R2351:Triobp	UTSW	15	79004580	missense	probably benign	0.09
R2902:Triobp	UTSW	15	78973418	missense	possibly damaging	0.90
R3801:Triobp	UTSW	15	78973700	missense	probably benign	0.04
R3959:Triobp	UTSW	15	79002389	nonsense	probably null
R4003:Triobp	UTSW	15	78959977	unclassified	probably benign
R4084:Triobp	UTSW	15	78973671	missense	probably benign	0.19
R4482:Triobp	UTSW	15	78966563	missense	possibly damaging	0.87
R4662:Triobp	UTSW	15	78993269	missense	probably damaging	1.00
R4732:Triobp	UTSW	15	78967113	missense	probably damaging	0.99
R4733:Triobp	UTSW	15	78967113	missense	probably damaging	0.99
R4789:Triobp	UTSW	15	78991028	missense	probably damaging	1.00
R4968:Triobp	UTSW	15	78966616	missense	probably benign	0.03
R4990:Triobp	UTSW	15	78967005	missense	probably benign	0.00
R5129:Triobp	UTSW	15	78961096	missense	probably benign	0.15
R5181:Triobp	UTSW	15	78967754	missense	probably benign	0.00
R5279:Triobp	UTSW	15	78994391	missense	possibly damaging	0.66
R5584:Triobp	UTSW	15	78968132	missense	possibly damaging	0.89
R5601:Triobp	UTSW	15	78973633	missense	probably damaging	1.00
R5810:Triobp	UTSW	15	78968267	missense	probably benign	0.07
R5969:Triobp	UTSW	15	78967540	missense	probably benign	0.05
R6722:Triobp	UTSW	15	79001565	missense	probably damaging	1.00
R6739:Triobp	UTSW	15	78966366	missense	possibly damaging	0.77
R6810:Triobp	UTSW	15	78966615	missense	possibly damaging	0.47
R7011:Triobp	UTSW	15	78978723	missense	probably damaging	0.98
R7015:Triobp	UTSW	15	78994060	missense	probably damaging	0.99
R7200:Triobp	UTSW	15	78966842	small deletion	probably benign
R7294:Triobp	UTSW	15	78973976	missense	probably damaging	0.99
R7688:Triobp	UTSW	15	78961111	splice site	probably null
R7805:Triobp	UTSW	15	78974004	missense	probably benign	0.37
R7972:Triobp	UTSW	15	78967986	missense	probably damaging	1.00
R7977:Triobp	UTSW	15	79001544	missense	probably damaging	1.00
R7987:Triobp	UTSW	15	79001544	missense	probably damaging	1.00
R7999:Triobp	UTSW	15	78959944	missense	probably damaging	0.99
R8344:Triobp	UTSW	15	78958275	missense	possibly damaging	0.67
R8348:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
R8446:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
R8448:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
R8469:Triobp	UTSW	15	78967019	missense	probably benign	0.00
R8491:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
R8492:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
R8493:Triobp	UTSW	15	78994126	missense	possibly damaging	0.85
RF001:Triobp	UTSW	15	78967027	small insertion	probably benign
RF005:Triobp	UTSW	15	78967061	small insertion	probably benign
RF007:Triobp	UTSW	15	78967044	small insertion	probably benign
RF022:Triobp	UTSW	15	78974282	missense	probably benign	0.05
RF028:Triobp	UTSW	15	78967039	small insertion	probably benign
RF032:Triobp	UTSW	15	78967036	small insertion	probably benign
RF035:Triobp	UTSW	15	78967039	small insertion	probably benign
RF039:Triobp	UTSW	15	78967036	small insertion	probably benign
RF039:Triobp	UTSW	15	78967039	small insertion	probably benign
RF040:Triobp	UTSW	15	78967063	small insertion	probably benign
RF049:Triobp	UTSW	15	78967061	small insertion	probably benign
RF051:Triobp	UTSW	15	78967034	small insertion	probably benign
RF058:Triobp	UTSW	15	78967044	small insertion	probably benign
X0026:Triobp	UTSW	15	78960023	missense	possibly damaging	0.94
Z1177:Triobp	UTSW	15	79002181	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACCCTAGGACTCCCTGTAC -3'
(R):5'- TTCCTGGAATTACTCCCCTGAG -3'

Sequencing Primer
(F):5'- TAGGACTCCCTGTACCCAGAG -3'
(R):5'- CCTTGAGAGAAGGTCCTGGG -3'

Posted On

2015-09-24