Incidental Mutation 'R0346:Ap3b1'
ID34294
Institutional Source Beutler Lab
Gene Symbol Ap3b1
Ensembl Gene ENSMUSG00000021686
Gene Nameadaptor-related protein complex 3, beta 1 subunit
Synonymsrecombination induced mutation 2, rim2, Hps2, beta3A, AP-3
MMRRC Submission 038553-MU
Accession Numbers

Ap3b1: Ncbi RefSeq: NM_009680; MGI: 1333879;

Is this an essential gene? Possibly essential (E-score: 0.546) question?
Stock #R0346 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location94358960-94566317 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 94445971 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 365 (R365*)
Ref Sequence ENSEMBL: ENSMUSP00000022196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022196]
Predicted Effect probably null
Transcript: ENSMUST00000022196
AA Change: R365*
SMART Domains Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686
AA Change: R365*

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Pfam:Adaptin_N 39 586 1.2e-170 PFAM
Pfam:SEEEED 672 812 1.3e-27 PFAM
AP3B1_C 822 969 1.58e-78 SMART
Blast:B2 993 1103 2e-27 BLAST
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.4%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]
Allele List at MGI

All alleles(53) : Targeted(4) Gene trapped(34) Spontaneous(14) Chemically induced(1)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,566,278 I4406L probably damaging Het
Abca16 T A 7: 120,435,932 C314S probably damaging Het
Add3 C T 19: 53,216,956 R46* probably null Het
Alas1 A T 9: 106,243,351 S82T possibly damaging Het
Alkbh5 C G 11: 60,538,741 R107G possibly damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
AU021092 T C 16: 5,216,854 D168G possibly damaging Het
Bcl2 G A 1: 106,712,562 R107C probably damaging Het
Caln1 C A 5: 130,822,921 H184N possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Ccdc191 T C 16: 43,938,952 V372A probably damaging Het
Ccng2 T G 5: 93,270,894 I126S probably damaging Het
Cep85 A T 4: 134,132,422 N643K probably damaging Het
Clvs2 G C 10: 33,622,546 S129R possibly damaging Het
Cntn1 G T 15: 92,232,087 probably benign Het
Cttn A T 7: 144,452,539 probably benign Het
Dedd2 T C 7: 25,211,269 S161G possibly damaging Het
Dnajb13 T C 7: 100,503,925 D263G probably damaging Het
Dppa4 T A 16: 48,289,324 probably benign Het
Ear2 A G 14: 44,102,906 E7G probably damaging Het
Eif2b4 A G 5: 31,188,108 probably benign Het
Etl4 G T 2: 20,759,652 probably null Het
Fbxo15 T A 18: 84,960,221 probably null Het
Gm8765 T C 13: 50,703,310 Y995H probably benign Het
Gm9970 A G 5: 31,240,838 probably benign Het
Hap1 A G 11: 100,356,029 S17P probably benign Het
Hgd C T 16: 37,588,774 probably benign Het
Inpp5f T A 7: 128,690,668 L16Q probably damaging Het
Islr2 G A 9: 58,198,343 R545* probably null Het
Itgav G T 2: 83,792,609 C675F probably damaging Het
Kif13a T A 13: 46,814,219 I403L possibly damaging Het
Kif14 T A 1: 136,468,160 I68N probably damaging Het
Kif26a G T 12: 112,179,348 K1764N probably null Het
Lrrd1 C A 5: 3,850,215 F173L probably benign Het
Mroh4 G C 15: 74,614,292 probably benign Het
Mrvi1 T C 7: 110,898,976 D404G probably damaging Het
Msh5 A G 17: 35,029,888 V723A probably benign Het
Mybph T G 1: 134,197,754 I279S probably damaging Het
Myh4 A T 11: 67,260,326 I1936L probably benign Het
Myo1h A T 5: 114,355,209 T704S probably benign Het
Nav2 C A 7: 49,604,585 T2377K probably benign Het
Nipbl T G 15: 8,360,956 Q276H probably damaging Het
Nlrp9b T C 7: 20,024,515 L559P probably damaging Het
Nup210l T A 3: 90,189,438 V1318E probably damaging Het
Olfr1427 A T 19: 12,099,439 S67T probably damaging Het
Olfr18 A G 9: 20,314,411 S170P probably benign Het
Olfr385 A G 11: 73,589,457 Y94H probably damaging Het
Olfr765 C A 10: 129,046,473 V197F possibly damaging Het
P2ry13 T C 3: 59,209,566 T264A possibly damaging Het
Plekhg5 T C 4: 152,114,253 L966P probably benign Het
Prss35 A G 9: 86,755,351 K58R probably benign Het
Ptafr T A 4: 132,580,079 L260* probably null Het
Pum1 A T 4: 130,779,805 T1157S possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf145 A G 11: 44,555,164 Y275C probably damaging Het
Rpl6 A T 5: 121,208,491 K218N possibly damaging Het
Rps6 T C 4: 86,855,981 T128A probably benign Het
Ryr1 G T 7: 29,067,588 probably benign Het
Scel A T 14: 103,529,984 Q26H probably damaging Het
Sfxn4 A T 19: 60,858,673 D57E probably benign Het
Slc35d1 A C 4: 103,190,847 L240R probably damaging Het
Smcr8 A G 11: 60,779,750 I575V probably benign Het
Syk G A 13: 52,640,659 M476I probably damaging Het
Tbcel A T 9: 42,437,243 probably benign Het
Tob2 C A 15: 81,858,223 G65W probably damaging Het
Trim16 A G 11: 62,840,694 N464D probably benign Het
Trim36 T C 18: 46,199,709 probably benign Het
Trpv4 C A 5: 114,630,529 probably benign Het
Tsga10 T A 1: 37,840,519 T64S possibly damaging Het
Ttc26 T C 6: 38,409,435 C364R probably damaging Het
Vars2 A T 17: 35,664,864 probably benign Het
Vmn1r72 C A 7: 11,669,694 V276L probably benign Het
Vps13a T A 19: 16,677,969 K1898N probably benign Het
Vps18 A G 2: 119,297,164 M823V probably damaging Het
Washc2 T C 6: 116,220,523 probably benign Het
Zfp763 A T 17: 33,019,747 H141Q probably benign Het
Other mutations in Ap3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Ap3b1 APN 13 94390863 missense probably damaging 1.00
IGL00766:Ap3b1 APN 13 94542884 splice site probably benign
IGL01784:Ap3b1 APN 13 94493739 missense probably damaging 1.00
IGL01979:Ap3b1 APN 13 94448463 nonsense probably null
IGL02040:Ap3b1 APN 13 94408845 critical splice donor site probably null
IGL02119:Ap3b1 APN 13 94462403 missense probably benign 0.01
IGL02247:Ap3b1 APN 13 94394795 critical splice donor site probably null
IGL02303:Ap3b1 APN 13 94528319 missense unknown
IGL02493:Ap3b1 APN 13 94404020 missense probably damaging 0.98
IGL02551:Ap3b1 APN 13 94418091 missense probably damaging 0.99
IGL02651:Ap3b1 APN 13 94477021 missense probably damaging 1.00
IGL02832:Ap3b1 APN 13 94528327 missense unknown
IGL03033:Ap3b1 APN 13 94448495 missense probably benign 0.15
IGL03101:Ap3b1 APN 13 94455398 missense probably benign 0.00
bella UTSW 13 94528257 missense unknown
bullet_gray UTSW 13 94451087 critical splice donor site probably benign
R0034:Ap3b1 UTSW 13 94479885 splice site probably benign
R0265:Ap3b1 UTSW 13 94493681 missense unknown
R0270:Ap3b1 UTSW 13 94404118 splice site probably benign
R0422:Ap3b1 UTSW 13 94462460 missense probably damaging 0.99
R0496:Ap3b1 UTSW 13 94472938 splice site probably benign
R0508:Ap3b1 UTSW 13 94565714 missense unknown
R0764:Ap3b1 UTSW 13 94479879 splice site probably benign
R1506:Ap3b1 UTSW 13 94446143 splice site probably benign
R1593:Ap3b1 UTSW 13 94501927 missense unknown
R1660:Ap3b1 UTSW 13 94408812 missense probably damaging 0.98
R1735:Ap3b1 UTSW 13 94493717 missense unknown
R1791:Ap3b1 UTSW 13 94408797 missense possibly damaging 0.63
R1818:Ap3b1 UTSW 13 94471704 missense possibly damaging 0.48
R2280:Ap3b1 UTSW 13 94528216 missense unknown
R3031:Ap3b1 UTSW 13 94565643 missense unknown
R3037:Ap3b1 UTSW 13 94445978 critical splice donor site probably null
R4401:Ap3b1 UTSW 13 94418099 missense probably damaging 1.00
R4402:Ap3b1 UTSW 13 94418099 missense probably damaging 1.00
R4403:Ap3b1 UTSW 13 94418099 missense probably damaging 1.00
R4532:Ap3b1 UTSW 13 94565735 missense unknown
R4624:Ap3b1 UTSW 13 94483226 missense unknown
R4626:Ap3b1 UTSW 13 94404078 missense possibly damaging 0.51
R4754:Ap3b1 UTSW 13 94403960 missense probably damaging 1.00
R4788:Ap3b1 UTSW 13 94565641 missense unknown
R4847:Ap3b1 UTSW 13 94471779 missense probably benign 0.15
R4886:Ap3b1 UTSW 13 94472805 missense possibly damaging 0.50
R5096:Ap3b1 UTSW 13 94479849 missense unknown
R5628:Ap3b1 UTSW 13 94477048 missense unknown
R5671:Ap3b1 UTSW 13 94528257 missense unknown
R5677:Ap3b1 UTSW 13 94528196 missense unknown
R5862:Ap3b1 UTSW 13 94547770 missense unknown
R5941:Ap3b1 UTSW 13 94440273 missense probably benign 0.02
R5941:Ap3b1 UTSW 13 94483265 missense probably damaging 0.96
R6043:Ap3b1 UTSW 13 94476993 missense probably benign 0.09
R6212:Ap3b1 UTSW 13 94451073 missense probably damaging 1.00
R6212:Ap3b1 UTSW 13 94493699 missense unknown
R6301:Ap3b1 UTSW 13 94528295 missense unknown
R6765:Ap3b1 UTSW 13 94462509 missense probably benign 0.02
R6812:Ap3b1 UTSW 13 94479861 missense unknown
R6888:Ap3b1 UTSW 13 94408791 missense probably benign 0.42
R6901:Ap3b1 UTSW 13 94418142 missense probably benign 0.00
R7157:Ap3b1 UTSW 13 94532034 nonsense probably null
R7422:Ap3b1 UTSW 13 94528165 missense unknown
R7642:Ap3b1 UTSW 13 94477032 missense probably benign 0.19
R7710:Ap3b1 UTSW 13 94451073 missense probably damaging 1.00
R7867:Ap3b1 UTSW 13 94483263 missense unknown
R7950:Ap3b1 UTSW 13 94483263 missense unknown
Predicted Primers PCR Primer
(F):5'- CGATTGAATGGCACTCTGAGCTTTCTG -3'
(R):5'- AACTTGATTCCTAGCCACATGAAGACC -3'

Sequencing Primer
(F):5'- GCACTCTGAGCTTTCTGATAAG -3'
(R):5'- GTTTACAGATGCTAGAAGCTACTCC -3'
Posted On2013-05-09