Mutagenetix > Incidental Mutations

Incidental Mutation 'R0346:Ap3b1'

34294

Institutional Source

Beutler Lab

Gene Symbol

Ap3b1

Ensembl Gene

ENSMUSG00000021686

Gene Name

adaptor-related protein complex 3, beta 1 subunit

Synonyms

recombination induced mutation 2, rim2, Hps2, beta3A, AP-3

MMRRC Submission

038553-MU

Accession Numbers

Ap3b1: Ncbi RefSeq: NM_009680; MGI: 1333879;

Is this an essential gene?

Possibly essential (E-score: 0.507) question?

Stock #

R0346 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

94358960-94566317 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 94445971 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 365 (R365*)

Ref Sequence

ENSEMBL: ENSMUSP00000022196 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022196]

Predicted Effect

probably null
Transcript: ENSMUST00000022196
AA Change: R365*

SMART Domains

Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686
AA Change: R365*

Domain	Start	End	E-Value	Type
low complexity region	10	24	N/A	INTRINSIC
Pfam:Adaptin_N	39	586	1.2e-170	PFAM
Pfam:SEEEED	672	812	1.3e-27	PFAM
AP3B1_C	822	969	1.58e-78	SMART
Blast:B2	993	1103	2e-27	BLAST

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.5%
3x: 98.9%
10x: 97.7%
20x: 96.4%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]

Allele List at MGI

All alleles(53) : Targeted(4) Gene trapped(34) Spontaneous(14) Chemically induced(1)

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	T	11: 9,566,278	I4406L	probably damaging	Het
Abca16	T	A	7: 120,435,932	C314S	probably damaging	Het
Add3	C	T	19: 53,216,956	R46*	probably null	Het
Alas1	A	T	9: 106,243,351	S82T	possibly damaging	Het
Alkbh5	C	G	11: 60,538,741	R107G	possibly damaging	Het
Ass1	A	T	2: 31,514,819	N371Y	probably damaging	Het
AU021092	T	C	16: 5,216,854	D168G	possibly damaging	Het
Bcl2	G	A	1: 106,712,562	R107C	probably damaging	Het
Caln1	C	A	5: 130,822,921	H184N	possibly damaging	Het
Camta1	C	A	4: 151,075,140	R1614L	probably damaging	Het
Ccdc191	T	C	16: 43,938,952	V372A	probably damaging	Het
Ccng2	T	G	5: 93,270,894	I126S	probably damaging	Het
Cep85	A	T	4: 134,132,422	N643K	probably damaging	Het
Clvs2	G	C	10: 33,622,546	S129R	possibly damaging	Het
Cntn1	G	T	15: 92,232,087		probably benign	Het
Cttn	A	T	7: 144,452,539		probably benign	Het
Dedd2	T	C	7: 25,211,269	S161G	possibly damaging	Het
Dnajb13	T	C	7: 100,503,925	D263G	probably damaging	Het
Dppa4	T	A	16: 48,289,324		probably benign	Het
Ear2	A	G	14: 44,102,906	E7G	probably damaging	Het
Eif2b4	A	G	5: 31,188,108		probably benign	Het
Etl4	G	T	2: 20,759,652		probably null	Het
Fbxo15	T	A	18: 84,960,221		probably null	Het
Gm8765	T	C	13: 50,703,310	Y995H	probably benign	Het
Gm9970	A	G	5: 31,240,838		probably benign	Het
Hap1	A	G	11: 100,356,029	S17P	probably benign	Het
Hgd	C	T	16: 37,588,774		probably benign	Het
Inpp5f	T	A	7: 128,690,668	L16Q	probably damaging	Het
Islr2	G	A	9: 58,198,343	R545*	probably null	Het
Itgav	G	T	2: 83,792,609	C675F	probably damaging	Het
Kif13a	T	A	13: 46,814,219	I403L	possibly damaging	Het
Kif14	T	A	1: 136,468,160	I68N	probably damaging	Het
Kif26a	G	T	12: 112,179,348	K1764N	probably null	Het
Lrrd1	C	A	5: 3,850,215	F173L	probably benign	Het
Mroh4	G	C	15: 74,614,292		probably benign	Het
Mrvi1	T	C	7: 110,898,976	D404G	probably damaging	Het
Msh5	A	G	17: 35,029,888	V723A	probably benign	Het
Mybph	T	G	1: 134,197,754	I279S	probably damaging	Het
Myh4	A	T	11: 67,260,326	I1936L	probably benign	Het
Myo1h	A	T	5: 114,355,209	T704S	probably benign	Het
Nav2	C	A	7: 49,604,585	T2377K	probably benign	Het
Nipbl	T	G	15: 8,360,956	Q276H	probably damaging	Het
Nlrp9b	T	C	7: 20,024,515	L559P	probably damaging	Het
Nup210l	T	A	3: 90,189,438	V1318E	probably damaging	Het
Olfr1427	A	T	19: 12,099,439	S67T	probably damaging	Het
Olfr18	A	G	9: 20,314,411	S170P	probably benign	Het
Olfr385	A	G	11: 73,589,457	Y94H	probably damaging	Het
Olfr765	C	A	10: 129,046,473	V197F	possibly damaging	Het
P2ry13	T	C	3: 59,209,566	T264A	possibly damaging	Het
Plekhg5	T	C	4: 152,114,253	L966P	probably benign	Het
Prss35	A	G	9: 86,755,351	K58R	probably benign	Het
Ptafr	T	A	4: 132,580,079	L260*	probably null	Het
Pum1	A	T	4: 130,779,805	T1157S	possibly damaging	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rnf145	A	G	11: 44,555,164	Y275C	probably damaging	Het
Rpl6	A	T	5: 121,208,491	K218N	possibly damaging	Het
Rps6	T	C	4: 86,855,981	T128A	probably benign	Het
Ryr1	G	T	7: 29,067,588		probably benign	Het
Scel	A	T	14: 103,529,984	Q26H	probably damaging	Het
Sfxn4	A	T	19: 60,858,673	D57E	probably benign	Het
Slc35d1	A	C	4: 103,190,847	L240R	probably damaging	Het
Smcr8	A	G	11: 60,779,750	I575V	probably benign	Het
Syk	G	A	13: 52,640,659	M476I	probably damaging	Het
Tbcel	A	T	9: 42,437,243		probably benign	Het
Tob2	C	A	15: 81,858,223	G65W	probably damaging	Het
Trim16	A	G	11: 62,840,694	N464D	probably benign	Het
Trim36	T	C	18: 46,199,709		probably benign	Het
Trpv4	C	A	5: 114,630,529		probably benign	Het
Tsga10	T	A	1: 37,840,519	T64S	possibly damaging	Het
Ttc26	T	C	6: 38,409,435	C364R	probably damaging	Het
Vars2	A	T	17: 35,664,864		probably benign	Het
Vmn1r72	C	A	7: 11,669,694	V276L	probably benign	Het
Vps13a	T	A	19: 16,677,969	K1898N	probably benign	Het
Vps18	A	G	2: 119,297,164	M823V	probably damaging	Het
Washc2	T	C	6: 116,220,523		probably benign	Het
Zfp763	A	T	17: 33,019,747	H141Q	probably benign	Het

Other mutations in Ap3b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00660:Ap3b1	APN	13	94390863	missense	probably damaging	1.00
IGL00766:Ap3b1	APN	13	94542884	splice site	probably benign
IGL01784:Ap3b1	APN	13	94493739	missense	probably damaging	1.00
IGL01979:Ap3b1	APN	13	94448463	nonsense	probably null
IGL02040:Ap3b1	APN	13	94408845	critical splice donor site	probably null
IGL02119:Ap3b1	APN	13	94462403	missense	probably benign	0.01
IGL02247:Ap3b1	APN	13	94394795	critical splice donor site	probably null
IGL02303:Ap3b1	APN	13	94528319	missense	unknown
IGL02493:Ap3b1	APN	13	94404020	missense	probably damaging	0.98
IGL02551:Ap3b1	APN	13	94418091	missense	probably damaging	0.99
IGL02651:Ap3b1	APN	13	94477021	missense	probably damaging	1.00
IGL02832:Ap3b1	APN	13	94528327	missense	unknown
IGL03033:Ap3b1	APN	13	94448495	missense	probably benign	0.15
IGL03101:Ap3b1	APN	13	94455398	missense	probably benign	0.00
bella	UTSW	13	94528257	missense	unknown
bullet_gray	UTSW	13	94451087	critical splice donor site	probably benign
R0034:Ap3b1	UTSW	13	94479885	splice site	probably benign
R0265:Ap3b1	UTSW	13	94493681	missense	unknown
R0270:Ap3b1	UTSW	13	94404118	splice site	probably benign
R0422:Ap3b1	UTSW	13	94462460	missense	probably damaging	0.99
R0496:Ap3b1	UTSW	13	94472938	splice site	probably benign
R0508:Ap3b1	UTSW	13	94565714	missense	unknown
R0764:Ap3b1	UTSW	13	94479879	splice site	probably benign
R1506:Ap3b1	UTSW	13	94446143	splice site	probably benign
R1593:Ap3b1	UTSW	13	94501927	missense	unknown
R1660:Ap3b1	UTSW	13	94408812	missense	probably damaging	0.98
R1735:Ap3b1	UTSW	13	94493717	missense	unknown
R1791:Ap3b1	UTSW	13	94408797	missense	possibly damaging	0.63
R1818:Ap3b1	UTSW	13	94471704	missense	possibly damaging	0.48
R2280:Ap3b1	UTSW	13	94528216	missense	unknown
R3031:Ap3b1	UTSW	13	94565643	missense	unknown
R3037:Ap3b1	UTSW	13	94445978	critical splice donor site	probably null
R4401:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4402:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4403:Ap3b1	UTSW	13	94418099	missense	probably damaging	1.00
R4532:Ap3b1	UTSW	13	94565735	missense	unknown
R4624:Ap3b1	UTSW	13	94483226	missense	unknown
R4626:Ap3b1	UTSW	13	94404078	missense	possibly damaging	0.51
R4754:Ap3b1	UTSW	13	94403960	missense	probably damaging	1.00
R4788:Ap3b1	UTSW	13	94565641	missense	unknown
R4847:Ap3b1	UTSW	13	94471779	missense	probably benign	0.15
R4886:Ap3b1	UTSW	13	94472805	missense	possibly damaging	0.50
R5096:Ap3b1	UTSW	13	94479849	missense	unknown
R5628:Ap3b1	UTSW	13	94477048	missense	unknown
R5671:Ap3b1	UTSW	13	94528257	missense	unknown
R5677:Ap3b1	UTSW	13	94528196	missense	unknown
R5862:Ap3b1	UTSW	13	94547770	missense	unknown
R5941:Ap3b1	UTSW	13	94440273	missense	probably benign	0.02
R5941:Ap3b1	UTSW	13	94483265	missense	probably damaging	0.96
R6043:Ap3b1	UTSW	13	94476993	missense	probably benign	0.09
R6212:Ap3b1	UTSW	13	94451073	missense	probably damaging	1.00
R6212:Ap3b1	UTSW	13	94493699	missense	unknown
R6301:Ap3b1	UTSW	13	94528295	missense	unknown
R6765:Ap3b1	UTSW	13	94462509	missense	probably benign	0.02
R6812:Ap3b1	UTSW	13	94479861	missense	unknown
R6888:Ap3b1	UTSW	13	94408791	missense	probably benign	0.42
R6901:Ap3b1	UTSW	13	94418142	missense	probably benign	0.00
R7157:Ap3b1	UTSW	13	94532034	nonsense	probably null
R7422:Ap3b1	UTSW	13	94528165	missense	unknown
R7642:Ap3b1	UTSW	13	94477032	missense	probably benign	0.19
R7710:Ap3b1	UTSW	13	94451073	missense	probably damaging	1.00
R7757:Ap3b1	UTSW	13	94528158	splice site	probably null
R7867:Ap3b1	UTSW	13	94483263	missense	unknown
R8492:Ap3b1	UTSW	13	94394786

Predicted Primers

PCR Primer
(F):5'- CGATTGAATGGCACTCTGAGCTTTCTG -3'
(R):5'- AACTTGATTCCTAGCCACATGAAGACC -3'

Sequencing Primer
(F):5'- GCACTCTGAGCTTTCTGATAAG -3'
(R):5'- GTTTACAGATGCTAGAAGCTACTCC -3'

Posted On

2013-05-09