Incidental Mutation 'R0346:Ap3b1'
ID 34294
Institutional Source Beutler Lab
Gene Symbol Ap3b1
Ensembl Gene ENSMUSG00000021686
Gene Name adaptor-related protein complex 3, beta 1 subunit
Synonyms AP-3, Hps2, beta3A, rim2, recombination induced mutation 2
MMRRC Submission 038553-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.296) question?
Stock # R0346 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 94495468-94702825 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 94582479 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 365 (R365*)
Ref Sequence ENSEMBL: ENSMUSP00000022196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022196]
AlphaFold Q9Z1T1
Predicted Effect probably null
Transcript: ENSMUST00000022196
AA Change: R365*
SMART Domains Protein: ENSMUSP00000022196
Gene: ENSMUSG00000021686
AA Change: R365*

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
Pfam:Adaptin_N 39 586 1.2e-170 PFAM
Pfam:SEEEED 672 812 1.3e-27 PFAM
AP3B1_C 822 969 1.58e-78 SMART
Blast:B2 993 1103 2e-27 BLAST
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.4%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may play a role in organelle biogenesis associated with melanosomes, platelet dense granules, and lysosomes. The encoded protein is part of the heterotetrameric AP-3 protein complex which interacts with the scaffolding protein clathrin. Mutations in this gene are associated with Hermansky-Pudlak syndrome type 2. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2012]
PHENOTYPE: Homozygous mutants exhibit hypopigmentation, elevated kidney levels of lysosomal enzymes, platelet storage pool deficiency, reduced ipsilateral projections from the retina to brain, reduced sensitivity of dark-adapted retina and shortened life span. [provided by MGI curators]
Allele List at MGI

All alleles(53) : Targeted(4) Gene trapped(34) Spontaneous(14) Chemically induced(1)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,516,278 (GRCm39) I4406L probably damaging Het
Abca16 T A 7: 120,035,155 (GRCm39) C314S probably damaging Het
Add3 C T 19: 53,205,387 (GRCm39) R46* probably null Het
Alas1 A T 9: 106,120,550 (GRCm39) S82T possibly damaging Het
Alkbh5 C G 11: 60,429,567 (GRCm39) R107G possibly damaging Het
Ass1 A T 2: 31,404,831 (GRCm39) N371Y probably damaging Het
AU021092 T C 16: 5,034,718 (GRCm39) D168G possibly damaging Het
Bcl2 G A 1: 106,640,292 (GRCm39) R107C probably damaging Het
Caln1 C A 5: 130,851,762 (GRCm39) H184N possibly damaging Het
Camta1 C A 4: 151,159,597 (GRCm39) R1614L probably damaging Het
Ccdc191 T C 16: 43,759,315 (GRCm39) V372A probably damaging Het
Ccng2 T G 5: 93,418,753 (GRCm39) I126S probably damaging Het
Cep85 A T 4: 133,859,733 (GRCm39) N643K probably damaging Het
Clvs2 G C 10: 33,498,542 (GRCm39) S129R possibly damaging Het
Cntn1 G T 15: 92,129,968 (GRCm39) probably benign Het
Cttn A T 7: 144,006,276 (GRCm39) probably benign Het
Dedd2 T C 7: 24,910,694 (GRCm39) S161G possibly damaging Het
Dnajb13 T C 7: 100,153,132 (GRCm39) D263G probably damaging Het
Dppa4 T A 16: 48,109,687 (GRCm39) probably benign Het
Ear2 A G 14: 44,340,363 (GRCm39) E7G probably damaging Het
Eif2b4 A G 5: 31,345,452 (GRCm39) probably benign Het
Etl4 G T 2: 20,764,463 (GRCm39) probably null Het
Fbxo15 T A 18: 84,978,346 (GRCm39) probably null Het
Gm9970 A G 5: 31,398,182 (GRCm39) probably benign Het
Hap1 A G 11: 100,246,855 (GRCm39) S17P probably benign Het
Hgd C T 16: 37,409,136 (GRCm39) probably benign Het
Ift56 T C 6: 38,386,370 (GRCm39) C364R probably damaging Het
Inpp5f T A 7: 128,292,392 (GRCm39) L16Q probably damaging Het
Irag1 T C 7: 110,498,183 (GRCm39) D404G probably damaging Het
Islr2 G A 9: 58,105,626 (GRCm39) R545* probably null Het
Itgav G T 2: 83,622,953 (GRCm39) C675F probably damaging Het
Kif13a T A 13: 46,967,695 (GRCm39) I403L possibly damaging Het
Kif14 T A 1: 136,395,898 (GRCm39) I68N probably damaging Het
Kif26a G T 12: 112,145,782 (GRCm39) K1764N probably null Het
Lrrd1 C A 5: 3,900,215 (GRCm39) F173L probably benign Het
Mroh4 G C 15: 74,486,141 (GRCm39) probably benign Het
Msh5 A G 17: 35,248,864 (GRCm39) V723A probably benign Het
Mybph T G 1: 134,125,492 (GRCm39) I279S probably damaging Het
Myh4 A T 11: 67,151,152 (GRCm39) I1936L probably benign Het
Myo1h A T 5: 114,493,270 (GRCm39) T704S probably benign Het
Nav2 C A 7: 49,254,333 (GRCm39) T2377K probably benign Het
Nipbl T G 15: 8,390,440 (GRCm39) Q276H probably damaging Het
Nlrp9b T C 7: 19,758,440 (GRCm39) L559P probably damaging Het
Nup210l T A 3: 90,096,745 (GRCm39) V1318E probably damaging Het
Or1e26 A G 11: 73,480,283 (GRCm39) Y94H probably damaging Het
Or4z4 A T 19: 12,076,803 (GRCm39) S67T probably damaging Het
Or6c8b C A 10: 128,882,342 (GRCm39) V197F possibly damaging Het
Or7e178 A G 9: 20,225,707 (GRCm39) S170P probably benign Het
P2ry13 T C 3: 59,116,987 (GRCm39) T264A possibly damaging Het
Plekhg5 T C 4: 152,198,710 (GRCm39) L966P probably benign Het
Prss35 A G 9: 86,637,404 (GRCm39) K58R probably benign Het
Ptafr T A 4: 132,307,390 (GRCm39) L260* probably null Het
Pum1 A T 4: 130,507,116 (GRCm39) T1157S possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Rnf145 A G 11: 44,445,991 (GRCm39) Y275C probably damaging Het
Rpl6 A T 5: 121,346,554 (GRCm39) K218N possibly damaging Het
Rps6 T C 4: 86,774,218 (GRCm39) T128A probably benign Het
Ryr1 G T 7: 28,767,013 (GRCm39) probably benign Het
Scel A T 14: 103,767,420 (GRCm39) Q26H probably damaging Het
Sfxn4 A T 19: 60,847,111 (GRCm39) D57E probably benign Het
Slc35d1 A C 4: 103,048,044 (GRCm39) L240R probably damaging Het
Smcr8 A G 11: 60,670,576 (GRCm39) I575V probably benign Het
Spata31e4 T C 13: 50,857,346 (GRCm39) Y995H probably benign Het
Syk G A 13: 52,794,695 (GRCm39) M476I probably damaging Het
Tbcel A T 9: 42,348,539 (GRCm39) probably benign Het
Tob2 C A 15: 81,742,424 (GRCm39) G65W probably damaging Het
Trim16 A G 11: 62,731,520 (GRCm39) N464D probably benign Het
Trim36 T C 18: 46,332,776 (GRCm39) probably benign Het
Trpv4 C A 5: 114,768,590 (GRCm39) probably benign Het
Tsga10 T A 1: 37,879,600 (GRCm39) T64S possibly damaging Het
Vars2 A T 17: 35,975,756 (GRCm39) probably benign Het
Vmn1r72 C A 7: 11,403,621 (GRCm39) V276L probably benign Het
Vps13a T A 19: 16,655,333 (GRCm39) K1898N probably benign Het
Vps18 A G 2: 119,127,645 (GRCm39) M823V probably damaging Het
Washc2 T C 6: 116,197,484 (GRCm39) probably benign Het
Zfp763 A T 17: 33,238,721 (GRCm39) H141Q probably benign Het
Other mutations in Ap3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Ap3b1 APN 13 94,527,371 (GRCm39) missense probably damaging 1.00
IGL00766:Ap3b1 APN 13 94,679,392 (GRCm39) splice site probably benign
IGL01784:Ap3b1 APN 13 94,630,247 (GRCm39) missense probably damaging 1.00
IGL01979:Ap3b1 APN 13 94,584,971 (GRCm39) nonsense probably null
IGL02040:Ap3b1 APN 13 94,545,353 (GRCm39) critical splice donor site probably null
IGL02119:Ap3b1 APN 13 94,598,911 (GRCm39) missense probably benign 0.01
IGL02247:Ap3b1 APN 13 94,531,303 (GRCm39) critical splice donor site probably null
IGL02303:Ap3b1 APN 13 94,664,827 (GRCm39) missense unknown
IGL02493:Ap3b1 APN 13 94,540,528 (GRCm39) missense probably damaging 0.98
IGL02551:Ap3b1 APN 13 94,554,599 (GRCm39) missense probably damaging 0.99
IGL02651:Ap3b1 APN 13 94,613,529 (GRCm39) missense probably damaging 1.00
IGL02832:Ap3b1 APN 13 94,664,835 (GRCm39) missense unknown
IGL03033:Ap3b1 APN 13 94,585,003 (GRCm39) missense probably benign 0.15
IGL03101:Ap3b1 APN 13 94,591,906 (GRCm39) missense probably benign 0.00
bella UTSW 13 94,664,765 (GRCm39) missense unknown
bullet_gray UTSW 13 94,587,594 (GRCm39) critical splice donor site probably benign
cuttlefish UTSW 13 94,584,959 (GRCm39) critical splice acceptor site probably null
Gastropod UTSW 13 94,679,348 (GRCm39) missense unknown
razor UTSW 13 94,630,239 (GRCm39) missense unknown
Slime UTSW 13 94,540,586 (GRCm39) missense possibly damaging 0.51
slug UTSW 13 94,545,353 (GRCm39) critical splice donor site probably null
snail UTSW 13 94,616,393 (GRCm39) splice site probably benign
stalk UTSW 13 94,609,439 (GRCm39) critical splice donor site probably null
R0034:Ap3b1 UTSW 13 94,616,393 (GRCm39) splice site probably benign
R0265:Ap3b1 UTSW 13 94,630,189 (GRCm39) missense unknown
R0270:Ap3b1 UTSW 13 94,540,626 (GRCm39) splice site probably benign
R0422:Ap3b1 UTSW 13 94,598,968 (GRCm39) missense probably damaging 0.99
R0496:Ap3b1 UTSW 13 94,609,446 (GRCm39) splice site probably benign
R0508:Ap3b1 UTSW 13 94,702,222 (GRCm39) missense unknown
R0764:Ap3b1 UTSW 13 94,616,387 (GRCm39) splice site probably benign
R1506:Ap3b1 UTSW 13 94,582,651 (GRCm39) splice site probably benign
R1593:Ap3b1 UTSW 13 94,638,435 (GRCm39) missense unknown
R1660:Ap3b1 UTSW 13 94,545,320 (GRCm39) missense probably damaging 0.98
R1735:Ap3b1 UTSW 13 94,630,225 (GRCm39) missense unknown
R1791:Ap3b1 UTSW 13 94,545,305 (GRCm39) missense possibly damaging 0.63
R1818:Ap3b1 UTSW 13 94,608,212 (GRCm39) missense possibly damaging 0.48
R2280:Ap3b1 UTSW 13 94,664,724 (GRCm39) missense unknown
R3031:Ap3b1 UTSW 13 94,702,151 (GRCm39) missense unknown
R3037:Ap3b1 UTSW 13 94,582,486 (GRCm39) critical splice donor site probably null
R4401:Ap3b1 UTSW 13 94,554,607 (GRCm39) missense probably damaging 1.00
R4402:Ap3b1 UTSW 13 94,554,607 (GRCm39) missense probably damaging 1.00
R4403:Ap3b1 UTSW 13 94,554,607 (GRCm39) missense probably damaging 1.00
R4532:Ap3b1 UTSW 13 94,702,243 (GRCm39) missense unknown
R4624:Ap3b1 UTSW 13 94,619,734 (GRCm39) missense unknown
R4626:Ap3b1 UTSW 13 94,540,586 (GRCm39) missense possibly damaging 0.51
R4754:Ap3b1 UTSW 13 94,540,468 (GRCm39) missense probably damaging 1.00
R4788:Ap3b1 UTSW 13 94,702,149 (GRCm39) missense unknown
R4847:Ap3b1 UTSW 13 94,608,287 (GRCm39) missense probably benign 0.15
R4886:Ap3b1 UTSW 13 94,609,313 (GRCm39) missense possibly damaging 0.50
R5096:Ap3b1 UTSW 13 94,616,357 (GRCm39) missense unknown
R5628:Ap3b1 UTSW 13 94,613,556 (GRCm39) missense unknown
R5671:Ap3b1 UTSW 13 94,664,765 (GRCm39) missense unknown
R5677:Ap3b1 UTSW 13 94,664,704 (GRCm39) missense unknown
R5862:Ap3b1 UTSW 13 94,684,278 (GRCm39) missense unknown
R5941:Ap3b1 UTSW 13 94,619,773 (GRCm39) missense probably damaging 0.96
R5941:Ap3b1 UTSW 13 94,576,781 (GRCm39) missense probably benign 0.02
R6043:Ap3b1 UTSW 13 94,613,501 (GRCm39) missense probably benign 0.09
R6212:Ap3b1 UTSW 13 94,630,207 (GRCm39) missense unknown
R6212:Ap3b1 UTSW 13 94,587,581 (GRCm39) missense probably damaging 1.00
R6301:Ap3b1 UTSW 13 94,664,803 (GRCm39) missense unknown
R6765:Ap3b1 UTSW 13 94,599,017 (GRCm39) missense probably benign 0.02
R6812:Ap3b1 UTSW 13 94,616,369 (GRCm39) missense unknown
R6888:Ap3b1 UTSW 13 94,545,299 (GRCm39) missense probably benign 0.42
R6901:Ap3b1 UTSW 13 94,554,650 (GRCm39) missense probably benign 0.00
R7157:Ap3b1 UTSW 13 94,668,542 (GRCm39) nonsense probably null
R7422:Ap3b1 UTSW 13 94,664,673 (GRCm39) missense unknown
R7642:Ap3b1 UTSW 13 94,613,540 (GRCm39) missense probably benign 0.19
R7710:Ap3b1 UTSW 13 94,587,581 (GRCm39) missense probably damaging 1.00
R7757:Ap3b1 UTSW 13 94,664,666 (GRCm39) splice site probably null
R7867:Ap3b1 UTSW 13 94,619,771 (GRCm39) missense unknown
R8492:Ap3b1 UTSW 13 94,531,294 (GRCm39) missense possibly damaging 0.60
R8706:Ap3b1 UTSW 13 94,545,353 (GRCm39) critical splice donor site probably null
R8749:Ap3b1 UTSW 13 94,664,725 (GRCm39) missense unknown
R8876:Ap3b1 UTSW 13 94,540,586 (GRCm39) missense possibly damaging 0.51
R8889:Ap3b1 UTSW 13 94,679,348 (GRCm39) missense unknown
R8892:Ap3b1 UTSW 13 94,679,348 (GRCm39) missense unknown
R9065:Ap3b1 UTSW 13 94,608,223 (GRCm39) missense probably damaging 1.00
R9152:Ap3b1 UTSW 13 94,630,239 (GRCm39) missense unknown
R9152:Ap3b1 UTSW 13 94,609,439 (GRCm39) critical splice donor site probably null
R9166:Ap3b1 UTSW 13 94,608,236 (GRCm39) missense probably damaging 1.00
R9218:Ap3b1 UTSW 13 94,584,959 (GRCm39) critical splice acceptor site probably null
R9269:Ap3b1 UTSW 13 94,540,570 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGATTGAATGGCACTCTGAGCTTTCTG -3'
(R):5'- AACTTGATTCCTAGCCACATGAAGACC -3'

Sequencing Primer
(F):5'- GCACTCTGAGCTTTCTGATAAG -3'
(R):5'- GTTTACAGATGCTAGAAGCTACTCC -3'
Posted On 2013-05-09