Mutagenetix > Incidental Mutation

Incidental Mutation 'R4558:Sgsm1'

342942

Institutional Source

Beutler Lab

Gene Symbol

Sgsm1

Ensembl Gene

ENSMUSG00000042216

Gene Name

small G protein signaling modulator 1

Synonyms

Rutbc2, 2410098H20Rik, D5Bwg1524e

MMRRC Submission

042005-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4558 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

113243220-113310786 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

G to A at 113258111 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000084106 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048112] [ENSMUST00000057209]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000048112

SMART Domains

Protein: ENSMUSP00000046544
Gene: ENSMUSG00000042216

Domain	Start	End	E-Value	Type
RUN	127	187	6.52e-18	SMART
low complexity region	401	413	N/A	INTRINSIC
low complexity region	454	469	N/A	INTRINSIC
TBC	559	1053	2.88e-29	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000057209

SMART Domains

Protein: ENSMUSP00000084106
Gene: ENSMUSG00000042216

Domain	Start	End	E-Value	Type
low complexity region	114	126	N/A	INTRINSIC
low complexity region	167	182	N/A	INTRINSIC
TBC	272	766	2.88e-29	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145708

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147856

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

100% (36/36)

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017G19Rik	A	G	3: 40,513,091		noncoding transcript	Het
A830018L16Rik	C	A	1: 11,972,076	S440*	probably null	Het
Acot11	T	C	4: 106,748,366	N583S	probably damaging	Het
Alox12	T	G	11: 70,253,063	M164L	probably benign	Het
Atad2b	A	G	12: 4,943,223	I247M	probably benign	Het
Bmpr2	T	A	1: 59,845,692	M279K	probably damaging	Het
Cacna2d3	T	C	14: 29,103,713	T502A	possibly damaging	Het
Casp12	A	T	9: 5,352,742	Y188F	probably damaging	Het
Catsperb	A	G	12: 101,591,540	Y790C	possibly damaging	Het
Cnbd1	G	T	4: 19,055,095	N110K	possibly damaging	Het
Fam122b	G	A	X: 53,260,677		probably benign	Het
Fam189a2	G	A	19: 24,030,549	S130L	probably damaging	Het
Fam227b	C	T	2: 126,127,043	S37N	probably benign	Het
Fsip2	T	C	2: 82,984,953	S3677P	possibly damaging	Het
Gm10764	A	G	10: 87,290,820		noncoding transcript	Het
H2-Q6	T	C	17: 35,428,315	V312A	probably benign	Het
Hecw1	T	A	13: 14,247,605	D972V	probably damaging	Het
Kalrn	G	A	16: 33,987,208	T2597I	possibly damaging	Het
Kng1	C	A	16: 23,077,418		probably null	Het
Med13	T	C	11: 86,299,054	T1010A	probably damaging	Het
Nbeal1	C	T	1: 60,281,310	R2021*	probably null	Het
Ncapg	A	T	5: 45,676,644	T341S	probably benign	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Pcdhb4	A	G	18: 37,309,964	I776V	probably benign	Het
Ppp4r4	T	C	12: 103,606,933	V697A	probably benign	Het
Pramef12	T	C	4: 144,395,972	M1V	probably null	Het
Psd4	G	A	2: 24,404,794	V789M	probably damaging	Het
Rasa3	T	C	8: 13,598,259	E135G	probably damaging	Het
Serpinb9c	T	A	13: 33,154,499	E139V	probably benign	Het
Tmem161b	A	G	13: 84,251,244	I6M	possibly damaging	Het
Upf2	A	G	2: 5,973,593	M423V	unknown	Het
Vmn1r207-ps	A	G	13: 22,726,411		noncoding transcript	Het

Other mutations in Sgsm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00230:Sgsm1	APN	5	113245064	missense	probably benign	0.00
IGL00503:Sgsm1	APN	5	113276142	missense	probably benign	0.00
IGL01377:Sgsm1	APN	5	113276182	splice site	probably benign
IGL01602:Sgsm1	APN	5	113285665	missense	possibly damaging	0.92
IGL01605:Sgsm1	APN	5	113285665	missense	possibly damaging	0.92
IGL01669:Sgsm1	APN	5	113263490	missense	probably benign
IGL01920:Sgsm1	APN	5	113273605	missense	probably damaging	1.00
IGL01951:Sgsm1	APN	5	113286767	splice site	probably benign
IGL02387:Sgsm1	APN	5	113253063	missense	possibly damaging	0.93
IGL02690:Sgsm1	APN	5	113286767	splice site	probably benign
IGL03177:Sgsm1	APN	5	113250993	missense	probably damaging	1.00
IGL03186:Sgsm1	APN	5	113285021	missense	probably benign	0.00
IGL03398:Sgsm1	APN	5	113255316	missense	possibly damaging	0.67
caliente	UTSW	5	113280462	intron	probably benign
Chili	UTSW	5	113258123	intron	probably benign
pimiento	UTSW	5	113263257	missense	probably benign	0.15
R0048:Sgsm1	UTSW	5	113268750	missense	probably damaging	1.00
R0058:Sgsm1	UTSW	5	113285087	missense	probably damaging	1.00
R0058:Sgsm1	UTSW	5	113285087	missense	probably damaging	1.00
R0082:Sgsm1	UTSW	5	113288836	missense	probably benign	0.01
R0085:Sgsm1	UTSW	5	113279270	splice site	probably benign
R0099:Sgsm1	UTSW	5	113274360	splice site	probably benign
R0269:Sgsm1	UTSW	5	113286929	critical splice acceptor site	probably null
R0310:Sgsm1	UTSW	5	113263705	missense	probably benign	0.00
R0325:Sgsm1	UTSW	5	113288835	missense	probably damaging	0.99
R0420:Sgsm1	UTSW	5	113263759	missense	probably benign	0.16
R0594:Sgsm1	UTSW	5	113310562	missense	probably benign	0.00
R0599:Sgsm1	UTSW	5	113245028	missense	probably damaging	1.00
R0631:Sgsm1	UTSW	5	113285123	splice site	probably benign
R0744:Sgsm1	UTSW	5	113279184	missense	probably benign	0.38
R0833:Sgsm1	UTSW	5	113279184	missense	probably benign	0.38
R0919:Sgsm1	UTSW	5	113258842	missense	probably damaging	1.00
R0944:Sgsm1	UTSW	5	113265874	missense	probably benign	0.40
R1169:Sgsm1	UTSW	5	113279485	missense	probably damaging	1.00
R1232:Sgsm1	UTSW	5	113273711	nonsense	probably null
R1473:Sgsm1	UTSW	5	113263257	missense	probably benign	0.15
R1535:Sgsm1	UTSW	5	113263269	missense	possibly damaging	0.93
R1796:Sgsm1	UTSW	5	113273617	missense	possibly damaging	0.58
R1878:Sgsm1	UTSW	5	113263515	missense	probably damaging	0.97
R2084:Sgsm1	UTSW	5	113285400	missense	probably damaging	1.00
R3855:Sgsm1	UTSW	5	113263259	missense	probably benign	0.01
R3856:Sgsm1	UTSW	5	113263259	missense	probably benign	0.01
R4294:Sgsm1	UTSW	5	113285404	missense	probably damaging	1.00
R4373:Sgsm1	UTSW	5	113258123	intron	probably benign
R4610:Sgsm1	UTSW	5	113255307	missense	probably damaging	1.00
R4667:Sgsm1	UTSW	5	113260047	critical splice donor site	probably null
R4838:Sgsm1	UTSW	5	113282626	missense	probably damaging	1.00
R4890:Sgsm1	UTSW	5	113280462	intron	probably benign
R4992:Sgsm1	UTSW	5	113282620	missense	possibly damaging	0.89
R5366:Sgsm1	UTSW	5	113251039	missense	possibly damaging	0.91
R5776:Sgsm1	UTSW	5	113250957	missense	probably damaging	1.00
R5813:Sgsm1	UTSW	5	113250956	missense	probably damaging	1.00
R6000:Sgsm1	UTSW	5	113286838	missense	probably damaging	1.00
R6354:Sgsm1	UTSW	5	113282656	missense	probably damaging	0.99
R6440:Sgsm1	UTSW	5	113279131	critical splice donor site	probably null
R6831:Sgsm1	UTSW	5	113280380	missense	probably damaging	0.97
R7307:Sgsm1	UTSW	5	113273646	missense	probably benign	0.00
R7309:Sgsm1	UTSW	5	113268846	splice site	probably null
R7387:Sgsm1	UTSW	5	113263700	missense	probably damaging	1.00
R7439:Sgsm1	UTSW	5	113274321	missense	probably damaging	0.99
R7485:Sgsm1	UTSW	5	113279635	splice site	probably null
R7624:Sgsm1	UTSW	5	113274335	nonsense	probably null
R7632:Sgsm1	UTSW	5	113276082	missense	possibly damaging	0.54
R7669:Sgsm1	UTSW	5	113253024	missense	probably damaging	1.00
R7727:Sgsm1	UTSW	5	113274327	missense	possibly damaging	0.95
R7732:Sgsm1	UTSW	5	113266330	missense	probably benign	0.26
R7961:Sgsm1	UTSW	5	113282644	missense	probably damaging	1.00
R8088:Sgsm1	UTSW	5	113255268	missense	probably damaging	1.00
R8213:Sgsm1	UTSW	5	113251011	missense	probably damaging	1.00
R8278:Sgsm1	UTSW	5	113260092	missense	probably damaging	0.98
R8480:Sgsm1	UTSW	5	113263418	missense	probably benign	0.01
R8796:Sgsm1	UTSW	5	113263257	missense	probably benign	0.15
R8816:Sgsm1	UTSW	5	113287231	missense	probably damaging	1.00
R8904:Sgsm1	UTSW	5	113273629	missense	probably benign	0.00
R8905:Sgsm1	UTSW	5	113273629	missense	probably benign	0.00
R8952:Sgsm1	UTSW	5	113284995	missense	probably damaging	1.00
R9046:Sgsm1	UTSW	5	113288859	missense	probably damaging	1.00
R9162:Sgsm1	UTSW	5	113282711	missense	probably damaging	1.00
R9249:Sgsm1	UTSW	5	113280335	missense	possibly damaging	0.86
R9375:Sgsm1	UTSW	5	113274273	missense	unknown
R9377:Sgsm1	UTSW	5	113288875	missense	probably damaging	1.00
R9461:Sgsm1	UTSW	5	113276032	critical splice donor site	probably null
R9662:Sgsm1	UTSW	5	113279231	missense	probably benign	0.03
R9722:Sgsm1	UTSW	5	113280341	missense	possibly damaging	0.75
R9726:Sgsm1	UTSW	5	113310552	missense	probably benign
Z1177:Sgsm1	UTSW	5	113282710	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCCTCTACCTCTGGAGCAC -3'
(R):5'- GGATGAGGTCTACCAAACGGA -3'

Sequencing Primer
(F):5'- TACCTCTGGAGCACTGGGC -3'
(R):5'- GTCCTGGAACTCAAGTTGTAGACC -3'

Posted On

2015-09-24